ID: 995743460

View in Genome Browser
Species Human (GRCh38)
Location 5:115378694-115378716
Sequence TTATTTCCACCACATTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995743460_995743463 11 Left 995743460 5:115378694-115378716 CCAATAGAATGTGGTGGAAATAA No data
Right 995743463 5:115378728-115378750 TTCCAAGGTAAGACTTGTGGAGG No data
995743460_995743462 8 Left 995743460 5:115378694-115378716 CCAATAGAATGTGGTGGAAATAA No data
Right 995743462 5:115378725-115378747 TAGTTCCAAGGTAAGACTTGTGG No data
995743460_995743461 -4 Left 995743460 5:115378694-115378716 CCAATAGAATGTGGTGGAAATAA No data
Right 995743461 5:115378713-115378735 ATAATATTGTGCTAGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995743460 Original CRISPR TTATTTCCACCACATTCTAT TGG (reversed) Intergenic
No off target data available for this crispr