ID: 995743461

View in Genome Browser
Species Human (GRCh38)
Location 5:115378713-115378735
Sequence ATAATATTGTGCTAGTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995743456_995743461 26 Left 995743456 5:115378664-115378686 CCCTGAATCTGGGCTGGCTTTGT No data
Right 995743461 5:115378713-115378735 ATAATATTGTGCTAGTTCCAAGG No data
995743460_995743461 -4 Left 995743460 5:115378694-115378716 CCAATAGAATGTGGTGGAAATAA No data
Right 995743461 5:115378713-115378735 ATAATATTGTGCTAGTTCCAAGG No data
995743457_995743461 25 Left 995743457 5:115378665-115378687 CCTGAATCTGGGCTGGCTTTGTG No data
Right 995743461 5:115378713-115378735 ATAATATTGTGCTAGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995743461 Original CRISPR ATAATATTGTGCTAGTTCCA AGG Intergenic
No off target data available for this crispr