ID: 995743463

View in Genome Browser
Species Human (GRCh38)
Location 5:115378728-115378750
Sequence TTCCAAGGTAAGACTTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995743460_995743463 11 Left 995743460 5:115378694-115378716 CCAATAGAATGTGGTGGAAATAA No data
Right 995743463 5:115378728-115378750 TTCCAAGGTAAGACTTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995743463 Original CRISPR TTCCAAGGTAAGACTTGTGG AGG Intergenic
No off target data available for this crispr