ID: 995743904

View in Genome Browser
Species Human (GRCh38)
Location 5:115383687-115383709
Sequence CAGAGTAAGCAGTCTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995743901_995743904 -1 Left 995743901 5:115383665-115383687 CCGGGGATTTATAGCCAGCAAGC No data
Right 995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995743904 Original CRISPR CAGAGTAAGCAGTCTGTGGA TGG Intergenic
No off target data available for this crispr