ID: 995751170

View in Genome Browser
Species Human (GRCh38)
Location 5:115454774-115454796
Sequence CGTGGCACTCAGAAGAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995751166_995751170 24 Left 995751166 5:115454727-115454749 CCACGTGAAAGAGAGGTGAAAGA No data
Right 995751170 5:115454774-115454796 CGTGGCACTCAGAAGAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995751170 Original CRISPR CGTGGCACTCAGAAGAACAC TGG Intergenic