ID: 995751170 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:115454774-115454796 |
Sequence | CGTGGCACTCAGAAGAACAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
995751166_995751170 | 24 | Left | 995751166 | 5:115454727-115454749 | CCACGTGAAAGAGAGGTGAAAGA | No data | ||
Right | 995751170 | 5:115454774-115454796 | CGTGGCACTCAGAAGAACACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
995751170 | Original CRISPR | CGTGGCACTCAGAAGAACAC TGG | Intergenic | ||