ID: 995752165

View in Genome Browser
Species Human (GRCh38)
Location 5:115463706-115463728
Sequence CAAGAAAATAAGCATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995752162_995752165 3 Left 995752162 5:115463680-115463702 CCCAAAGAGAGGGGAAAAGTCAC No data
Right 995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG No data
995752163_995752165 2 Left 995752163 5:115463681-115463703 CCAAAGAGAGGGGAAAAGTCACT No data
Right 995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG No data
995752161_995752165 4 Left 995752161 5:115463679-115463701 CCCCAAAGAGAGGGGAAAAGTCA No data
Right 995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995752165 Original CRISPR CAAGAAAATAAGCATGAGGA AGG Intergenic
No off target data available for this crispr