ID: 995752434

View in Genome Browser
Species Human (GRCh38)
Location 5:115467512-115467534
Sequence ACACATGGGATTGAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995752429_995752434 12 Left 995752429 5:115467477-115467499 CCAACAAAATGAGAAAATAAATT No data
Right 995752434 5:115467512-115467534 ACACATGGGATTGAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995752434 Original CRISPR ACACATGGGATTGAGGAGAC AGG Intergenic
No off target data available for this crispr