ID: 995752726

View in Genome Browser
Species Human (GRCh38)
Location 5:115470787-115470809
Sequence AGGGAAAATACTGCCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995752726_995752730 4 Left 995752726 5:115470787-115470809 CCCAGAGAGGCAGTATTTTCCCT No data
Right 995752730 5:115470814-115470836 TCACCTCTTAGTACTGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995752726 Original CRISPR AGGGAAAATACTGCCTCTCT GGG (reversed) Intergenic
No off target data available for this crispr