ID: 995752730

View in Genome Browser
Species Human (GRCh38)
Location 5:115470814-115470836
Sequence TCACCTCTTAGTACTGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995752725_995752730 8 Left 995752725 5:115470783-115470805 CCAGCCCAGAGAGGCAGTATTTT No data
Right 995752730 5:115470814-115470836 TCACCTCTTAGTACTGTAAGAGG No data
995752721_995752730 23 Left 995752721 5:115470768-115470790 CCAGGCTTCTACCTCCCAGCCCA No data
Right 995752730 5:115470814-115470836 TCACCTCTTAGTACTGTAAGAGG No data
995752724_995752730 9 Left 995752724 5:115470782-115470804 CCCAGCCCAGAGAGGCAGTATTT No data
Right 995752730 5:115470814-115470836 TCACCTCTTAGTACTGTAAGAGG No data
995752727_995752730 3 Left 995752727 5:115470788-115470810 CCAGAGAGGCAGTATTTTCCCTT No data
Right 995752730 5:115470814-115470836 TCACCTCTTAGTACTGTAAGAGG No data
995752723_995752730 12 Left 995752723 5:115470779-115470801 CCTCCCAGCCCAGAGAGGCAGTA No data
Right 995752730 5:115470814-115470836 TCACCTCTTAGTACTGTAAGAGG No data
995752726_995752730 4 Left 995752726 5:115470787-115470809 CCCAGAGAGGCAGTATTTTCCCT No data
Right 995752730 5:115470814-115470836 TCACCTCTTAGTACTGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995752730 Original CRISPR TCACCTCTTAGTACTGTAAG AGG Intergenic
No off target data available for this crispr