ID: 995756566

View in Genome Browser
Species Human (GRCh38)
Location 5:115511402-115511424
Sequence GTGAGCAGCACTACAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995756563_995756566 26 Left 995756563 5:115511353-115511375 CCTACAAAAATACAGTGACAATC No data
Right 995756566 5:115511402-115511424 GTGAGCAGCACTACAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995756566 Original CRISPR GTGAGCAGCACTACAACAGG AGG Intergenic
No off target data available for this crispr