ID: 995760122

View in Genome Browser
Species Human (GRCh38)
Location 5:115553701-115553723
Sequence CCCTCCAGGTTAGCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995760122_995760125 1 Left 995760122 5:115553701-115553723 CCAGCTTCTGCTAACCTGGAGGG No data
Right 995760125 5:115553725-115553747 GCCAAGTCAAAGTCAGCATCTGG No data
995760122_995760127 21 Left 995760122 5:115553701-115553723 CCAGCTTCTGCTAACCTGGAGGG No data
Right 995760127 5:115553745-115553767 TGGTTGTCCTGAGAACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995760122 Original CRISPR CCCTCCAGGTTAGCAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr