ID: 995762613

View in Genome Browser
Species Human (GRCh38)
Location 5:115579335-115579357
Sequence TTCATTTCACAGATAAAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 9, 3: 50, 4: 400}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995762606_995762613 22 Left 995762606 5:115579290-115579312 CCTCATAGAGGACAAAAGCCTTT 0: 1
1: 0
2: 0
3: 11
4: 177
Right 995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 400
995762607_995762613 4 Left 995762607 5:115579308-115579330 CCTTTAGAGATCCATCAATTCAA 0: 1
1: 0
2: 1
3: 11
4: 183
Right 995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 400
995762608_995762613 -7 Left 995762608 5:115579319-115579341 CCATCAATTCAACCCTTTCATTT 0: 1
1: 0
2: 0
3: 24
4: 351
Right 995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG 0: 1
1: 0
2: 9
3: 50
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995762613 Original CRISPR TTCATTTCACAGATAAAGGA GGG Exonic
902424989 1:16313466-16313488 TTCACTTCTCAAATAAAGGGAGG - Intronic
902853384 1:19180114-19180136 TCCATGTCACTGATAAGGGATGG + Intronic
904748933 1:32728887-32728909 TCCATTTGACAGATGAGGGATGG - Intergenic
905316372 1:37084089-37084111 TTCTTTTCACAAATGAAGTATGG + Intergenic
905957876 1:42014286-42014308 TTCACATCACAGAGAAAGAAGGG + Intronic
906757108 1:48328847-48328869 TCTATTTTACAGATAAAAGAGGG + Intronic
907774040 1:57495418-57495440 TTCATTTCAAAGATGAATTACGG + Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908543613 1:65144742-65144764 TTCCTTTTACAGATAAACTAAGG + Intergenic
908664925 1:66479444-66479466 TACATTTCACAGAAAATGCAAGG + Intergenic
909197287 1:72643727-72643749 TTGATTTCATAGAAAAAGGAAGG - Intergenic
909539620 1:76776537-76776559 TTCATTTTACAGATGAGGGTAGG + Intergenic
909834447 1:80236012-80236034 TTCATTTTACAGGCAAAGAAAGG - Intergenic
909913499 1:81289760-81289782 TTCATTTCACATCTATATGATGG - Intergenic
910240479 1:85080554-85080576 TTTATTTCACAGAGAAAACAGGG - Intronic
910278535 1:85473527-85473549 TTCATTTCACAAGGAAATGAAGG - Intronic
911488474 1:98532077-98532099 GTGCTGTCACAGATAAAGGATGG - Intergenic
912126296 1:106542950-106542972 TTCATTAGACAGATAAAGATTGG + Intergenic
913656377 1:120964223-120964245 TTCATTTCACAGAGGAAAGATGG - Intergenic
914520929 1:148415452-148415474 TTCATTTCACAGAGGAAAGATGG - Intergenic
914646339 1:149655953-149655975 TTCATTTCACAGAGGAAAGATGG - Intergenic
915028723 1:152857528-152857550 CTCATTTTACAGAAAAAGTAAGG - Intergenic
917096849 1:171406875-171406897 TTCACTTAAAAGATAAAGAATGG + Intergenic
917382755 1:174432393-174432415 TACATTTCCCAGATAAATGGGGG - Intronic
917888363 1:179411173-179411195 TACATTACAAAGAGAAAGGATGG + Exonic
918434614 1:184498629-184498651 TTGATTTCATATACAAAGGAGGG + Intronic
918576234 1:186063665-186063687 TTCATTTCAAAGAAATAGGTTGG + Intronic
919508374 1:198429199-198429221 TTCATTTTACAGATGAACCAGGG + Intergenic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
920977892 1:210803055-210803077 CTCATTTCACAGATCTGGGATGG + Intronic
921616536 1:217274462-217274484 TTTATTTTACAGATAAAAGTAGG + Intergenic
922672727 1:227524469-227524491 TTCATGTGACAGATAAAGGAAGG - Intergenic
923979131 1:239301050-239301072 ATCATATCACAGATAATTGAAGG + Intergenic
924154606 1:241163211-241163233 TTCTTTTCACTGATAAAGTTAGG - Intronic
924442435 1:244097363-244097385 TACATTTCACACATGAATGAGGG + Intergenic
924459797 1:244248842-244248864 CCCTTTTCACAGATAAAGGGAGG + Intergenic
1062858452 10:791328-791350 TGCCTTTCACAGAGGAAGGAAGG + Intergenic
1063197628 10:3758401-3758423 ATCATTTTGCAGATAAAGAAAGG + Intergenic
1064094157 10:12410613-12410635 TTTGTTTCACAGATCAATGAAGG + Intronic
1064471241 10:15638325-15638347 TGCCTTTCACAGACAGAGGAGGG - Intronic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1065279569 10:24120977-24120999 TGCATTACACAGGTAAAGTAAGG - Intronic
1065357649 10:24858056-24858078 TTCATTTCACAGTAAAACCAAGG - Intronic
1065664918 10:28048804-28048826 TTAATTTAACAGTTAGAGGAAGG + Intergenic
1066111197 10:32198629-32198651 TTCATTTTACAGACAAGGAATGG + Intergenic
1066476844 10:35756006-35756028 TACATTTAACAGTAAAAGGAGGG - Intergenic
1066804110 10:39226313-39226335 TTCATTTCACAGTTAAGCCATGG + Intergenic
1067387453 10:45829358-45829380 TTCAGTTCACAGTTAAATCACGG - Intronic
1067418673 10:46127907-46127929 TTCAGTTCACAGTTAAATCACGG + Intergenic
1067446820 10:46355253-46355275 TTCAGTTCACAGTTAAATCACGG + Intergenic
1067504025 10:46834485-46834507 TTCAGTTCACAGTTAAATCACGG + Intergenic
1067590562 10:47505514-47505536 TTCAGTTCACAGTTAAATCACGG - Intronic
1067637681 10:48013616-48013638 TTCAGTTCACAGTTAAATCACGG - Intergenic
1067875810 10:50006729-50006751 TTCAGTTCACAGTTAAATCACGG + Intronic
1067987197 10:51163383-51163405 TCCATTTCACAAATATGGGAGGG + Intronic
1068523131 10:58099532-58099554 TTAATTTAACAGAGAAATGAAGG - Intergenic
1069513844 10:69061993-69062015 TGCATTTCACAGATGATTGAAGG + Intergenic
1070134281 10:73678037-73678059 TTCAGTTCACAGTTAAATCACGG - Intronic
1070463589 10:76694486-76694508 TTCATTTCAAAAATAAAAGAGGG + Intergenic
1070616866 10:77975965-77975987 CTCAATTCAAAGATAAAGGGGGG + Exonic
1071159815 10:82732719-82732741 TGCATTTTACAAATAAAGAAAGG + Intronic
1071261490 10:83923449-83923471 TTCATTTCACAGATACGGAATGG - Intergenic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071273247 10:84028308-84028330 TACATTGCACATATAAAGCATGG + Intergenic
1071367713 10:84917007-84917029 TGGATTTCACAGAAAAATGATGG - Intergenic
1071607437 10:87006370-87006392 TTCAGTTCACAGTTAAATCATGG + Intergenic
1071722203 10:88158485-88158507 TTTGCTTCTCAGATAAAGGATGG + Intergenic
1071841322 10:89474843-89474865 TCCATTTTACAGACAAAGTAAGG + Intronic
1072101928 10:92237790-92237812 TTCATTTCATAGAGAAAAGGAGG - Intronic
1073720298 10:106161813-106161835 TTCATCACACAGATCTAGGAGGG - Intergenic
1073850406 10:107610582-107610604 TCCATTTCATAGATGAAGAAAGG + Intergenic
1074410929 10:113227910-113227932 TCCATCTCACAGAGAAAGTAAGG + Intergenic
1074931519 10:118131496-118131518 TTAATTTCAAAGATAAAGAAAGG + Intergenic
1076459544 10:130631869-130631891 CTCCTTTCACAGCCAAAGGAAGG - Intergenic
1077494833 11:2881932-2881954 TTCCCTTCTGAGATAAAGGAGGG - Intergenic
1081235079 11:40637255-40637277 ATTATTTCACATACAAAGGAGGG - Intronic
1081238687 11:40678028-40678050 TTATTCTCTCAGATAAAGGAAGG - Intronic
1081508284 11:43740921-43740943 TGCATTTAACACATGAAGGATGG + Intronic
1081514980 11:43819872-43819894 TTCATATTAAAGATAAATGAAGG - Intronic
1082018531 11:47511287-47511309 TTCAGGTCAAAGATAGAGGAGGG + Intronic
1083094826 11:60240054-60240076 TTTATCTTTCAGATAAAGGAAGG + Intronic
1085657115 11:78326041-78326063 TTCATTTCACAGATATTTTATGG + Intronic
1086400784 11:86459650-86459672 TCCATTTTACAGATAAGGAAAGG + Intronic
1088188381 11:107198919-107198941 ATCATGTCACACATAAAGCAAGG + Intergenic
1092920891 12:13230764-13230786 TCCAGTTCACAAATAAATGAAGG - Intergenic
1093870100 12:24280659-24280681 TTCATTTACCAGATACAGCAGGG + Intergenic
1094810477 12:34132990-34133012 TTCATGTGACAGATGAAAGAAGG + Intergenic
1095437510 12:42207304-42207326 TTCTTTTCAGAAATGAAGGAAGG - Intronic
1097311123 12:58120527-58120549 TTCTTTACATAGATAAGGGAAGG - Intergenic
1097510930 12:60538960-60538982 TTTTATTCACAGATAAAGGGAGG - Intergenic
1097780628 12:63699882-63699904 TTAGTTTCAAAGATAGAGGAAGG - Intergenic
1099368458 12:81799101-81799123 TCCATTTCACAGATACAGTAAGG - Intergenic
1100406835 12:94279288-94279310 TTCTTTTCAGGGATAATGGAAGG - Intronic
1101530108 12:105566060-105566082 TTTATTTCAGAGGTATAGGAAGG - Intergenic
1101866414 12:108523683-108523705 TTATTTTCACAAATAAATGAGGG - Intronic
1102006582 12:109592860-109592882 TTCCTTCCACATAGAAAGGAGGG + Intronic
1102084865 12:110127914-110127936 TTCATAAAACAGATTAAGGATGG - Intronic
1102479708 12:113213542-113213564 TCTATTTCACAGATGAAGAAAGG + Intronic
1104217954 12:126753031-126753053 TTTATTTCACAAGTTAAGGAGGG + Intergenic
1105566950 13:21558801-21558823 TCCATTTCACAGGTGAGGGATGG + Intronic
1105573511 13:21626768-21626790 TACATTTCACAAATAAATGAAGG - Intergenic
1106069633 13:26396273-26396295 TGTATTTCACAGATAAAGATTGG + Exonic
1107632321 13:42355199-42355221 TTCACTTCACAGATAAGAAAGGG - Intergenic
1107681826 13:42859718-42859740 ATCATTACACAGATGCAGGAAGG - Intergenic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1108543288 13:51464981-51465003 TTTATTTAAAACATAAAGGAGGG - Intergenic
1108682716 13:52793155-52793177 TTCATCTCAAAAAAAAAGGAGGG + Intergenic
1108764423 13:53609289-53609311 TACACTTCATGGATAAAGGATGG + Intergenic
1109781614 13:67117711-67117733 CCAATTTCACAGATAAAGGAGGG + Intronic
1109981224 13:69910792-69910814 TTCATTTAACTAATTAAGGAGGG + Intronic
1111504614 13:89171406-89171428 TTAATGCCACAGATATAGGAGGG + Intergenic
1111591877 13:90358230-90358252 TTCATTGCTGACATAAAGGAAGG - Intergenic
1111795257 13:92910964-92910986 TTCATTTAACAGATACATAAGGG - Intergenic
1111975492 13:94962684-94962706 TTCATGTTACAGATGAGGGAGGG + Intergenic
1113161841 13:107390706-107390728 GTCATTTCACAGATAAGAGAGGG + Intronic
1113207410 13:107933106-107933128 TGCATATTACAGAGAAAGGAGGG + Intergenic
1114663615 14:24366486-24366508 TTCATCTCGGAAATAAAGGAAGG - Intronic
1114947688 14:27706045-27706067 TTCATTTCAGAAAGAAAGGATGG + Intergenic
1115693402 14:35870430-35870452 TACATTTCACAGCTACAGAAAGG + Exonic
1116558104 14:46338815-46338837 TACATTTCACAAAGAAAGTATGG + Intergenic
1117550781 14:56833928-56833950 TTTATTCAACAGATATAGGATGG - Intergenic
1117785257 14:59277235-59277257 TTCATTTGCTAGATAAAGCAAGG - Intronic
1117818667 14:59625066-59625088 ATCATTTCAAATATAAGGGAGGG + Intronic
1118151189 14:63192591-63192613 ATTATTTCACAGGTTAAGGAAGG + Intergenic
1119571630 14:75679312-75679334 TTGACTTCAAAGATAGAGGAAGG + Intronic
1119701468 14:76758533-76758555 TCCATTTTACAGATGAAGAAAGG - Intergenic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1120138151 14:80895669-80895691 TTTATTTCACATGTAGAGGATGG - Intronic
1121862153 14:97328744-97328766 TTCATTTCACAGTTCAATGTAGG + Intergenic
1122042978 14:99002922-99002944 TTTCTTTCAAAGATAAAGTATGG + Intergenic
1123817677 15:23996301-23996323 CTCATTTCACAGACAAAGAGGGG - Intergenic
1123846801 15:24311518-24311540 CTCACTTCACAGACAAAGAAGGG - Intergenic
1125117965 15:36117988-36118010 TTTTTTTCATAGAAAAAGGAAGG + Intergenic
1125154064 15:36566309-36566331 TTCATGTAACTGATAAGGGATGG - Intergenic
1127197099 15:56599415-56599437 TATATTTATCAGATAAAGGATGG + Intergenic
1128418510 15:67469274-67469296 CTCATTTCTAAAATAAAGGAGGG + Intronic
1128739468 15:70073675-70073697 TTCATTTCAGAGATGAAAGGTGG + Intronic
1129141994 15:73607298-73607320 TGCATTTCACAGAAAAAGTTTGG - Intronic
1129309086 15:74692668-74692690 TTCATTTCACAAATGCAAGATGG + Intronic
1130175600 15:81565979-81566001 CACATTTTACAGATAAAGAAAGG + Intergenic
1130538892 15:84807234-84807256 TTCATTGCACTGATGAAGTAGGG - Intergenic
1130574922 15:85083244-85083266 TTCATGTCACTGACAAAGCAAGG - Intronic
1131304106 15:91226089-91226111 TTGATTTGAGAGATAAAGGGGGG + Exonic
1131406447 15:92168883-92168905 ATCATTTAAGAGAAAAAGGATGG - Intronic
1131745512 15:95443079-95443101 TTCATTCCAAAGTTAACGGAGGG + Intergenic
1132006265 15:98230280-98230302 TTCATTTTGCAGATAAGAGAAGG + Intergenic
1133166359 16:3950279-3950301 TTCACTTCACCGAGAAAGGAAGG - Intergenic
1134222389 16:12365259-12365281 TTCACTTCGCAGATGAAGAATGG - Intronic
1134755820 16:16666386-16666408 TTTATCTCACTGTTAAAGGATGG + Intergenic
1134990247 16:18692779-18692801 TTTATCTCACTGTTAAAGGATGG - Intergenic
1136419016 16:30120979-30121001 TTCATTTCAAAGATGAGGGGTGG - Intronic
1136933138 16:34436435-34436457 TTCATTTCAAAGACAAGGGAAGG + Intergenic
1136971434 16:34975379-34975401 TTCATTTCAAAGACAAGGGAAGG - Intergenic
1137509265 16:49084067-49084089 TTCATTTTATAGATAAGGAAAGG + Intergenic
1138045667 16:53721937-53721959 TTCATATCTCAGATAATTGATGG + Intronic
1139079086 16:63492218-63492240 TTCATTTAACAGGTATAGGAAGG + Intergenic
1139691405 16:68644415-68644437 TCCATTTCACAGCTAAACAAAGG - Intronic
1140300665 16:73754318-73754340 TTCATTTTAAAGGCAAAGGAGGG + Intergenic
1140682766 16:77401428-77401450 TCCATTTCAGAGATATAGAAAGG + Intronic
1140858144 16:78996020-78996042 TTCATTTCACTGAAAGAAGAGGG + Intronic
1140909511 16:79438598-79438620 TCCATTTCACAGAGGAGGGAAGG + Intergenic
1141018886 16:80476345-80476367 TTCATGTCATAGGAAAAGGAGGG + Intergenic
1141229947 16:82157284-82157306 TTCATTTTACAGATACACCACGG - Intronic
1141293515 16:82744146-82744168 TTCAGTTGACAGAGATAGGATGG + Intronic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1142553501 17:755860-755882 TACATGTCACAGTGAAAGGAGGG - Intergenic
1144260050 17:13509772-13509794 TTCATTTCACAGATGTTGAAAGG + Intronic
1144691070 17:17264333-17264355 TTCATTACACAGACACAGAAAGG + Intronic
1145046038 17:19617068-19617090 TTCATCTCACAGAGATAGCAGGG - Intergenic
1146461906 17:33052752-33052774 TTCACTGCACAGATAAACTAGGG + Intronic
1153385438 18:4489628-4489650 TCCATTTCTCAGATAAGGGCTGG + Intergenic
1153605703 18:6829106-6829128 TACATTTCACTGATGGAGGATGG - Intronic
1153949165 18:10043794-10043816 CCCATTCCACAGACAAAGGAAGG - Intergenic
1154174854 18:12079339-12079361 TACATTTCACAGAAATAGGAAGG + Intergenic
1156179189 18:34583125-34583147 TTAATTCCACAGATAAATGATGG + Intronic
1156660380 18:39339466-39339488 TACATTTAATAGAAAAAGGAAGG + Intergenic
1157156405 18:45271007-45271029 TACCTTACACACATAAAGGAAGG - Intronic
1157436691 18:47676403-47676425 TTCATTTCACACAAAATGGAGGG - Intergenic
1158011023 18:52727920-52727942 TTCATTTCATAGAGAAAGAGTGG + Intronic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1159492862 18:69161373-69161395 GTAATCACACAGATAAAGGAAGG + Intergenic
1159758851 18:72399402-72399424 CTGATTTCACAGCTACAGGAGGG + Intergenic
1160655754 19:268033-268055 TTCATATCACCAATAATGGATGG + Intergenic
1161423611 19:4189798-4189820 TTCATTTTATAGATGAGGGAGGG + Intronic
1161917264 19:7238036-7238058 TTCATTTCCCAGAGGAAGGATGG + Intronic
925272381 2:2621368-2621390 TTCATTTTACAGAAAAAAGAGGG - Intergenic
926304344 2:11627246-11627268 ATCATTTCACAGACAATTGAAGG - Intronic
926866802 2:17368946-17368968 TTCATTTAAAAGATACAGAATGG - Intergenic
927118644 2:19930478-19930500 ATCGTTTCACAGATAATGCATGG - Exonic
927906276 2:26860338-26860360 CTCATTTGACAGACACAGGAGGG - Intronic
928291197 2:30038854-30038876 TTCATTTGACAAATGAAGGAAGG - Intergenic
928352299 2:30570250-30570272 TTCTTTTTACTGATACAGGAGGG - Intronic
928591498 2:32820535-32820557 TTCATTTCAATGTTATAGGATGG - Intronic
929605377 2:43230610-43230632 GTCATTTCACAGAGAATGCAGGG + Intergenic
929645220 2:43619467-43619489 TTCTTTTTTCAGATAAAGGAAGG + Intergenic
929676362 2:43935562-43935584 TTAATTTCTCACATAAAAGAAGG - Intronic
929720586 2:44363379-44363401 TCCATTTCAAAAAAAAAGGAGGG - Intronic
931025718 2:58111778-58111800 TTGATTTCACAGAAAAAAAAAGG + Intronic
931040546 2:58293761-58293783 TTCATCCCCAAGATAAAGGATGG + Intergenic
931535219 2:63268275-63268297 TTGATTTCATAGAAACAGGAAGG + Intronic
931959239 2:67463752-67463774 TTTATTTTACAAATAGAGGAAGG - Intergenic
932668349 2:73716141-73716163 TTTTTTTAACAAATAAAGGAGGG + Intergenic
933075558 2:77921082-77921104 TTCTTTTCACAAATAAATCATGG + Intergenic
933601213 2:84332723-84332745 TTCATTTAAAAGAAGAAGGAAGG + Intergenic
933989927 2:87626874-87626896 TTGGTTTCACAGGTGAAGGAAGG - Intergenic
935174704 2:100639820-100639842 TCCCTTTCACAAAGAAAGGAAGG - Intergenic
935431702 2:102983033-102983055 CTCATGTGACAGATTAAGGATGG + Intergenic
936303918 2:111323950-111323972 TTGGTTTCACAGGTGAAGGAAGG + Intergenic
937430448 2:121833487-121833509 TTCATTGCACAGATGAGGCACGG + Intergenic
937596706 2:123683006-123683028 TTTATTACACAGACAAGGGAAGG - Intergenic
937639583 2:124196305-124196327 TTCACTTCACAGCTACATGATGG + Intronic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
939204058 2:139077096-139077118 TTCATTTCACATATAAATAAGGG - Intergenic
939955741 2:148526617-148526639 TTCTATTGACAGATAAATGAAGG - Intergenic
940164988 2:150761198-150761220 CTCCTCTCACAAATAAAGGAAGG + Intergenic
940399017 2:153225148-153225170 TTCATTTCACAGATTCAAGGAGG + Intergenic
940938400 2:159526799-159526821 TTCATTTCTCAGATATGGGTAGG + Intronic
941414150 2:165198018-165198040 TCCCTTTCAGAGGTAAAGGACGG + Intronic
942589247 2:177523259-177523281 CCCATTTCACAGATAAAATAAGG - Intronic
943080293 2:183251737-183251759 TCCATTTTACAAATAAAGAATGG + Intergenic
943270519 2:185796635-185796657 TTCACATCAAAGTTAAAGGAAGG + Exonic
944907650 2:204278788-204278810 TTCCTTTCATAGATAAATAAAGG + Intergenic
945529619 2:210935049-210935071 GTTTTTTCTCAGATAAAGGAAGG - Intergenic
945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG + Intronic
946094970 2:217266406-217266428 TTCAGTTCACACTTAAAGAAAGG - Intergenic
946551594 2:220807456-220807478 TTCATTCCCCAGAGAAAGGCAGG - Intergenic
946755249 2:222938668-222938690 TTCTCTTCTCAGATACAGGAAGG + Intronic
946773902 2:223117730-223117752 TTTATTTCACATAGGAAGGAGGG + Intronic
947127178 2:226881810-226881832 CCCATTTCACAAATAAAGAACGG - Intronic
948278279 2:236726910-236726932 TTCATTTCATAGACAAAGTCTGG - Intergenic
1169153990 20:3313791-3313813 TACCTTTCACTGAAAAAGGAAGG + Intronic
1169450100 20:5703413-5703435 TTCATTTAAGAAAGAAAGGATGG - Intergenic
1169607279 20:7336643-7336665 CTCATTTCACAGGTAATGAAAGG + Intergenic
1170498728 20:16952399-16952421 TTCATTAATCAGATAAAGGAAGG - Intergenic
1171213841 20:23337351-23337373 CTCAGATCCCAGATAAAGGATGG - Intergenic
1172307002 20:33887939-33887961 TCTATTTTACAGATAAAGAAAGG - Intergenic
1173036378 20:39414972-39414994 TTCATTTCTCAGATAAGGATTGG - Intergenic
1173880749 20:46410267-46410289 TTCCTTTAGCAGATAAATGAAGG - Intronic
1174302278 20:49591362-49591384 TCCATTCCACAGATAAGGGCTGG - Intergenic
1174676795 20:52365673-52365695 CTCATTTCACAGCTATGGGACGG + Intergenic
1175362091 20:58420417-58420439 TTCCTTTGGCAGATAAAGTAAGG + Intronic
1176006408 20:62866014-62866036 CTCATTTTAAAGAGAAAGGATGG + Intergenic
1176012423 20:62906156-62906178 TTCATTTCACTGAGAGATGAAGG + Intronic
1176945627 21:14977482-14977504 TTAATTTCACATAAAAAGAAAGG + Intronic
1177652223 21:23972223-23972245 ATAATTTCAGAGATAAAAGAAGG - Intergenic
1177963895 21:27703310-27703332 TTCAGTGTACAGATAGAGGAAGG - Intergenic
1178399166 21:32268978-32269000 TTCATTTAACAAATAAGGGGAGG + Exonic
1180389495 22:12212943-12212965 ATTATTTCAGAAATAAAGGAGGG - Intergenic
1182395875 22:30035620-30035642 TTCGTTTCACAGTGAAGGGAAGG - Intergenic
1182834263 22:33328900-33328922 CACATTTCACAGATAAGGAAAGG - Intronic
1182922631 22:34094227-34094249 TTCATTTCACAGCAAGAAGATGG - Intergenic
1183759744 22:39805270-39805292 TTCACCTCACAGCTGAAGGATGG + Intronic
949256985 3:2060327-2060349 TTCATTGCACAGCCAAGGGATGG + Intergenic
949294293 3:2502714-2502736 TTCATTTTACAGAGGAAGAAAGG + Intronic
949376149 3:3392565-3392587 TCCCTCTCACAGACAAAGGAAGG + Intergenic
949910850 3:8906544-8906566 TACATTTCACAGAGATAGAAGGG - Intronic
950104452 3:10379368-10379390 TTAATGTCACAGATGAAGGGCGG + Intronic
950356696 3:12416704-12416726 TTCATGTCATAGATAACGAATGG - Exonic
951712955 3:25603648-25603670 TTTATTTGAGAGATAAAGGAGGG + Intronic
952736457 3:36696170-36696192 TTCCTTCCACAAAAAAAGGAGGG - Intergenic
952830303 3:37559101-37559123 TTTATTTCTCAAATAAATGATGG + Intronic
953564498 3:44019831-44019853 TTCTTTTCACTGAGAAATGATGG - Intergenic
956046804 3:65204324-65204346 TTTCTTTCACAGAGAAAAGAAGG + Intergenic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956819203 3:72937750-72937772 TCCATTTAACAGTTAAAGAATGG - Intronic
957990563 3:87621824-87621846 GGCATTTCAGAGATACAGGAAGG - Intergenic
958437845 3:94119701-94119723 TTGTATTCAAAGATAAAGGAAGG - Intronic
958767497 3:98387289-98387311 TTGATTTCAAAGATTAAGAAAGG + Intergenic
959441447 3:106380891-106380913 TTCATTTCACTGAGAAAGGATGG - Intergenic
959679535 3:109077453-109077475 TTCATTTCACAAATAAGATATGG - Intronic
959883841 3:111476290-111476312 TTGAATTAACACATAAAGGAAGG + Intronic
960189125 3:114682076-114682098 TAAATTTCACAAAAAAAGGATGG + Intronic
960795021 3:121476337-121476359 TTTAATTTACAAATAAAGGAAGG - Intronic
961014755 3:123459001-123459023 ATCATGTCTCAGAAAAAGGAAGG + Intergenic
962083933 3:132170825-132170847 TTCATTTAACAGATGAACTAAGG - Intronic
963721283 3:148865080-148865102 CCCATTTTACAGATACAGGATGG - Intergenic
964251383 3:154721895-154721917 TTTATTACACAGAATAAGGAAGG - Intergenic
964326963 3:155557535-155557557 TTCATCTCACAGACAAGTGATGG - Intronic
964448582 3:156787081-156787103 TCCATTTCACTGATAAAGGAAGG + Intergenic
964493444 3:157262107-157262129 TTCATTGCAAAGTGAAAGGAGGG - Intronic
964963101 3:162453001-162453023 TTCATTTCACACACAAATTATGG + Intergenic
967616029 3:191567756-191567778 TTCATTTTAAAGATGAAGAAAGG - Intergenic
967803077 3:193685873-193685895 TTCATTTTATAGATAAAGCTAGG + Intronic
968359276 3:198135935-198135957 TTCATGTGACAGATGAAGGAAGG - Intergenic
968409063 4:370733-370755 TTCATTTCAAAAAAAAAAGAAGG - Intronic
970216381 4:13763124-13763146 TCCATTTCACAGATGAAGTGAGG - Intergenic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
970429172 4:15972959-15972981 TCCCCTTCACAGAAAAAGGAAGG + Intronic
970555114 4:17223762-17223784 TTCATTGCACAGATAATCTAAGG - Intergenic
971088951 4:23316948-23316970 AACATGTCACACATAAAGGAAGG - Intergenic
971122711 4:23721998-23722020 TGCTTTTCACATATAAAAGAAGG - Intergenic
971595931 4:28528747-28528769 TCCATCTCACAGATAGAGAAAGG + Intergenic
972271740 4:37517482-37517504 TTCATTACACAAATAAAACATGG - Intronic
972419823 4:38876851-38876873 CGCACTTCAAAGATAAAGGAAGG - Intronic
972765277 4:42147806-42147828 TTCACTTATCAGATATAGGATGG - Intronic
973268729 4:48237910-48237932 TTGATTTCTCAGATTAAGGTCGG - Intronic
974273946 4:59690530-59690552 TCCATTACACAGATGATGGAAGG + Intergenic
974808292 4:66911321-66911343 TTCATTTCACAGCTTTTGGAAGG + Intergenic
974974656 4:68875127-68875149 GTCATTTTATAGATAAATGAGGG + Intergenic
975418579 4:74135789-74135811 TTCATTCCAGAGATACAGGATGG + Intronic
975512082 4:75205303-75205325 TTCATTTGGCAGATTGAGGAGGG - Intergenic
975556185 4:75667575-75667597 TTCATTTGACAAGTAAAAGACGG - Intronic
976276311 4:83282732-83282754 TTCATTTTACAGATGAAAAACGG + Intronic
977394728 4:96455822-96455844 TCCATTTCACAGATGAAGTCTGG - Intergenic
977749611 4:100593502-100593524 TTGATTTCACAGATGAAGTATGG - Intronic
979767370 4:124477969-124477991 TTCATTTCAGATACAATGGAGGG + Intergenic
979935554 4:126690221-126690243 GCCTTTTCCCAGATAAAGGAAGG + Intergenic
980606447 4:135097525-135097547 ATTATTTTACAGATAAAGGTAGG - Intergenic
983585149 4:169346436-169346458 TTCATTTTATAGATTAAGGGAGG - Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984463791 4:180071410-180071432 TTCATCTAACTGACAAAGGAGGG - Intergenic
984997056 4:185444247-185444269 TTCATTTGAAAGATACAGGCCGG - Intronic
985119184 4:186622774-186622796 TTCATGAAACAGAAAAAGGATGG - Intronic
985440027 4:189975769-189975791 TTCATGTATCAAATAAAGGATGG + Intergenic
986412707 5:7497142-7497164 TTCATTTGAGAGATTAAAGATGG - Intronic
986600727 5:9469971-9469993 TTCATTTCACAAATGAAGATTGG - Intronic
988027645 5:25719362-25719384 TTCATTTAACAAATAGAGAAGGG - Intergenic
988570704 5:32362394-32362416 ATCATTCCAGAGACAAAGGAAGG + Intronic
988602395 5:32652000-32652022 TTCATTTCACAGATGAAAGAGGG - Intergenic
988823377 5:34910315-34910337 TTCATTCCACTGCTAAAGTAAGG + Intronic
988915071 5:35883872-35883894 TCCACTTCAAAGATAGAGGAAGG - Intergenic
988941340 5:36151425-36151447 GTTATTTTACAGATAAAGGAAGG + Intronic
989800920 5:45537942-45537964 TTCATATCACAGCCAAAGGACGG - Intronic
990466859 5:56078921-56078943 TTCATTTCATAGGTTAGGGAGGG + Intergenic
990954223 5:61328045-61328067 TTCATTTCTAAGTTAAAGGAGGG + Intergenic
992048370 5:72920654-72920676 TTCTTTTCACATATAAAGAGTGG - Intergenic
992670475 5:79055582-79055604 TTCATTTAAAAAATAAAGAATGG + Intronic
993559880 5:89392865-89392887 ATCTTTACACAGAAAAAGGAGGG - Intergenic
994648223 5:102496300-102496322 ATCATTTCAAACATAAAGAAGGG - Intronic
994977731 5:106831589-106831611 TGCATTTCAGAGATCAAAGAAGG + Intergenic
995762613 5:115579335-115579357 TTCATTTCACAGATAAAGGAGGG + Exonic
996172687 5:120313767-120313789 TTTATTCCACAGAAAAACGAGGG + Intergenic
996398085 5:123033137-123033159 TTTATTTTACAGATGAAGAAAGG - Intronic
997058645 5:130475338-130475360 TTCATTTAAAAGATACAGAATGG - Intergenic
997121469 5:131177601-131177623 AACATTTCACATGTAAAGGATGG - Intronic
998738072 5:145165923-145165945 TTCATTTCACAGACAAGACAAGG + Intergenic
998772962 5:145567144-145567166 TCCATTTCAGAGATAAATGCAGG + Intronic
998786773 5:145719595-145719617 TTCATTACACAGATAGAAGAGGG + Intronic
999051528 5:148529030-148529052 TCCATTTCACAGATGAGGAAAGG + Intronic
999658648 5:153835324-153835346 TTCATTTTACAGATAAAGTGAGG + Intergenic
1000467832 5:161601747-161601769 TGGATTTGACAGATAAATGAGGG + Intronic
1000790748 5:165604042-165604064 TGTATATCACAGATAAAGAATGG - Intergenic
1001315709 5:170639883-170639905 TTTCTTTCACACATAAAAGAAGG + Intronic
1002509655 5:179705533-179705555 TTCATTTCATAGATAAAGAAAGG - Intronic
1003547959 6:7076579-7076601 TCCATTTTACTGAAAAAGGAAGG + Intergenic
1003906866 6:10708962-10708984 TTTATTTCACAGAGTAAAGATGG - Exonic
1004044082 6:12010155-12010177 TTCATTTCACAAATGAGAGATGG + Intronic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1004536523 6:16508439-16508461 TTCATTGAAAGGATAAAGGATGG + Intronic
1005893036 6:30155263-30155285 GTCATTTCACAGATGACAGAAGG - Intronic
1006001714 6:30970267-30970289 TTCACTTTACAGCTAAAGAAGGG + Intergenic
1006435651 6:34024886-34024908 GTCATTTCAGAGATGAAGGTGGG - Intronic
1007278373 6:40692144-40692166 TTCATTTCATAGATAGAAAATGG + Intergenic
1007674666 6:43583265-43583287 TTCATTTCACAGAGACAAGATGG - Intronic
1009281151 6:61753413-61753435 AGCATTTCTCAGATAAAAGAGGG + Intronic
1010083342 6:71887710-71887732 TTCATCTCACAGATCAAGGTTGG + Intronic
1010115588 6:72304963-72304985 TTCCTTTCACAGATTAAATAAGG + Intronic
1010309061 6:74361390-74361412 TTATTTTGTCAGATAAAGGAAGG + Intergenic
1010448499 6:75976158-75976180 TTCATTTTACATTTAAATGAGGG + Intronic
1010567643 6:77436293-77436315 TATTTTTCACAGATAAAAGAAGG + Intergenic
1010743324 6:79532867-79532889 TTCATTTCACAAATAATGAATGG - Intronic
1012098100 6:94992138-94992160 ATGACTTCACAGTTAAAGGAAGG + Intergenic
1012215874 6:96583004-96583026 CTCATTTCAGAGGTAAAGAAAGG + Intronic
1013047538 6:106502258-106502280 TTCATGTCAAAGATCAAGAATGG - Intergenic
1014107416 6:117582737-117582759 TTCAATTCATGGATGAAGGATGG + Intronic
1014365572 6:120537022-120537044 TTCGTTTCACTGATAGAAGAAGG - Intergenic
1015045613 6:128772581-128772603 TTAATATCACAGAAAAAGGTAGG - Intergenic
1018708837 6:166483240-166483262 TTCATTTCCCAGAGAAAAGGAGG + Intronic
1018955010 6:168403678-168403700 ATCATTTGACAGAGAAAGCAAGG - Intergenic
1020482336 7:8677619-8677641 TTCATTTCACAGTAATGGGATGG - Intronic
1021031222 7:15738961-15738983 TTTCTTTAACACATAAAGGAAGG - Intergenic
1022219622 7:28300115-28300137 TTCATTTCACTCATACAGGGAGG + Intronic
1022586618 7:31619597-31619619 TTCTTTTAACAGTTAAAGAAGGG + Intronic
1022643283 7:32207787-32207809 GTCCCTTCACAGAGAAAGGAAGG - Intronic
1024621564 7:51162289-51162311 TTTCTTTCACAGATACAGAAAGG + Intronic
1026182840 7:68057164-68057186 TTCATTTTACAAATGAAGAAGGG - Intergenic
1028310766 7:89332116-89332138 TTCATCTCAAAGATAAATAAAGG + Intronic
1028879323 7:95861847-95861869 TAAATCTCACAGATGAAGGATGG - Intronic
1030328159 7:108244087-108244109 TTCATTTGAGAGAAAAAGAAAGG - Intronic
1030765691 7:113406644-113406666 TTGTTTTCACAAATAAAGTAAGG - Intergenic
1031832424 7:126644169-126644191 TTCATTCCACAAATAAAGTTTGG - Intronic
1033543892 7:142382149-142382171 TTCATTTCACAGAGAATGGATGG + Intergenic
1034018907 7:147619198-147619220 TTCATTTCACAAATAAGCCACGG - Intronic
1034863040 7:154616433-154616455 TTCAACTCAAAAATAAAGGAGGG - Intronic
1035262879 7:157673059-157673081 TTCATCTCAAAAAAAAAGGATGG - Intronic
1036171125 8:6486022-6486044 TTTATTTAAAAGTTAAAGGAGGG - Intronic
1036969321 8:13336681-13336703 CTCATTTTATAGATAAAGAAGGG - Intronic
1037613502 8:20496091-20496113 CTCATTTTACAGAAAAAGAAAGG - Intergenic
1038974743 8:32681826-32681848 TCCATTACACAGATATAGGAGGG + Intronic
1039098796 8:33917856-33917878 GACATTTTACAGATAAAGCAAGG + Intergenic
1039175237 8:34796616-34796638 TAAACTTCACAAATAAAGGAAGG + Intergenic
1039320940 8:36430348-36430370 TTCATTTCACAGATCAAGAATGG + Intergenic
1039766906 8:40638429-40638451 TTCATTCCACAGTTCAAGTAAGG + Intronic
1040440075 8:47432001-47432023 TTCATTTCACAGATAACTTCAGG - Intronic
1040760560 8:50836908-50836930 TTTATTACATAGATAAAGTAGGG - Intergenic
1041543264 8:59010974-59010996 TTCATTTCCCAAAGCAAGGATGG - Intronic
1043823066 8:84892239-84892261 TTCCTTTCATACATAAAGCAAGG - Intronic
1044208045 8:89515223-89515245 TTATTTTCACAGGTAAAAGAAGG + Intergenic
1045170417 8:99661082-99661104 TTCATATCACAAATGAGGGAAGG - Intronic
1045431124 8:102115960-102115982 TTTATTTCAGAAGTAAAGGACGG + Intronic
1045654401 8:104371958-104371980 TTCATATCACAGATGAGGAAAGG - Intronic
1045680315 8:104652423-104652445 TTCTTATCACAGATGAAGCATGG + Intronic
1045976083 8:108131774-108131796 TTCAAGTCTCAGATAGAGGAGGG - Intergenic
1046547528 8:115669534-115669556 TTCTTGCCACAGATAAAGGGCGG - Intronic
1046919582 8:119714175-119714197 TTCAATTCAAAGATACAGGCTGG + Intergenic
1047530108 8:125666799-125666821 TTCATTTCACAGGTAAGGGAAGG - Intergenic
1048475369 8:134737880-134737902 TTCATTTCTCAAATAATTGATGG - Intergenic
1050021183 9:1286040-1286062 TCCTGTTCACAGATGAAGGAAGG + Intergenic
1050432029 9:5571892-5571914 TCCATTTTACAGATAAGGAAAGG + Intergenic
1050977151 9:11953367-11953389 TTGATTTTAGAAATAAAGGAAGG - Intergenic
1053568875 9:39283444-39283466 TTCACTTGACATATAAAGCATGG - Intronic
1054128269 9:61335563-61335585 TTCACTTGACATATAAAGCATGG + Intergenic
1055228239 9:74027690-74027712 TTCAATTACCATATAAAGGAAGG + Intergenic
1055397071 9:75887630-75887652 TTGATTTAACAGATGAATGAGGG + Intergenic
1055404096 9:75956329-75956351 TTCATTCTACAGATAAATCAGGG + Intronic
1056698709 9:88883569-88883591 TTCATACCACAGATGAGGGATGG - Intergenic
1056919235 9:90771573-90771595 TTCATTTTACAGATAAACTGAGG - Intergenic
1057037744 9:91824183-91824205 GGCATCTTACAGATAAAGGATGG + Intronic
1058197158 9:101991779-101991801 TTTATCACACAGATATAGGAAGG + Intergenic
1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG + Intergenic
1059559322 9:115317079-115317101 TTCATGCCACAAAGAAAGGAGGG + Intronic
1060251356 9:121988969-121988991 TTCATTTTACAGGTAACAGAGGG + Intronic
1060517120 9:124272780-124272802 TTCATTTTACAGATGAGGAAAGG + Intronic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1062743964 9:138199654-138199676 TTCATGTGACAGATGAAGGAAGG - Intergenic
1187448963 X:19380452-19380474 TTCATTTCACAGTTAGTGGTGGG - Intronic
1187477011 X:19620262-19620284 TTCATTCCACAGATAAGGACTGG + Intronic
1187536144 X:20143029-20143051 TTCAATACACACAGAAAGGAAGG + Intergenic
1187547996 X:20271000-20271022 TTCTTTTCAGAGAGAAAGAAAGG + Intergenic
1189401114 X:40669572-40669594 CAGATTTCACAGAGAAAGGAGGG - Intronic
1189500664 X:41553497-41553519 TTCATTTTACACAAAAAGAAAGG - Intronic
1189534108 X:41919092-41919114 TTCATTCCACAGCTAATGAAAGG + Intronic
1189888046 X:45569694-45569716 TTCATTTGATAGATAAAACATGG + Intergenic
1190845793 X:54189237-54189259 CCCATTTCACAGATACAGGAAGG - Intergenic
1192547297 X:72024548-72024570 TTCATTTCACAGATGAGGACGGG + Intergenic
1193416769 X:81235061-81235083 TTCATTTGACAGATAAAGAAAGG - Intronic
1194269108 X:91787990-91788012 TTCATTTTACAGATAAGAAAAGG + Intronic
1194395705 X:93382763-93382785 TTCATTTCCCAAATATAGGAAGG - Intergenic
1194700440 X:97107324-97107346 TTCAATTCACAGATTAAGTATGG + Intronic
1195216017 X:102703740-102703762 TTAATATCAGAAATAAAGGAAGG + Intergenic
1195366761 X:104134109-104134131 TTCATTTCCAAGGCAAAGGAAGG + Intronic
1196772770 X:119311337-119311359 TTGTTTTCATAGATAAATGAGGG + Intergenic
1196810768 X:119627465-119627487 GTCATTCCACAGATTGAGGATGG + Intronic
1196943657 X:120802482-120802504 GTCTTTTCTTAGATAAAGGAAGG + Intergenic
1197302234 X:124795042-124795064 TTCATTTCAGAGAATAAGGGAGG - Intronic
1199014780 X:142802678-142802700 TCCATTTAAAAGATAAAGAATGG - Intergenic
1199209166 X:145186647-145186669 ATCATTTCAGAGATAAATGTAGG + Intergenic
1200788531 Y:7279669-7279691 GTCTTTTCCCAAATAAAGGAAGG + Intergenic
1201756405 Y:17491204-17491226 TTCATGGGACAGATGAAGGAAGG + Intergenic
1201785306 Y:17770697-17770719 TTCATTTCACATATACAGAAGGG + Intergenic
1201816247 Y:18135290-18135312 TTCATTTCACATATACAGAAGGG - Intergenic
1201845147 Y:18414781-18414803 TTCATGGGACAGATGAAGGAAGG - Intergenic
1201852943 Y:18507753-18507775 TTCATTTCACATATGCAGGTGGG - Intergenic
1201880378 Y:18812631-18812653 TTCATTTCACATATGCAGGTGGG + Intronic
1202244098 Y:22798854-22798876 TTTATTTCAAAGAGAAAGGAGGG - Intergenic
1202345415 Y:23918526-23918548 TTCATTTCACATATACAGGCAGG + Intergenic
1202397086 Y:24432604-24432626 TTTATTTCAAAGAGAAAGGAGGG - Intergenic
1202473695 Y:25237488-25237510 TTTATTTCAAAGAGAAAGGAGGG + Intergenic
1202525355 Y:25751563-25751585 TTCATTTCACATATACAGGCAGG - Intergenic