ID: 995762895

View in Genome Browser
Species Human (GRCh38)
Location 5:115582713-115582735
Sequence AAGAACAAGTAGAAATGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995762895 Original CRISPR AAGAACAAGTAGAAATGCTC TGG (reversed) Intronic
901149297 1:7089898-7089920 AATAACACGTAAAAAGGCTCAGG + Intronic
904101112 1:28028562-28028584 AAGAAGAAGAAGAAATCATCTGG - Intronic
905722910 1:40221959-40221981 AAAAACAAATAAAAATCCTCTGG - Intronic
905742682 1:40386491-40386513 CAGAACAAGTTAGAATGCTCAGG - Intronic
905830271 1:41059926-41059948 AAGGAAAATTAGAAATTCTCTGG - Intronic
906789761 1:48648506-48648528 AAGGACAAATAAGAATGCTCAGG + Intronic
909806355 1:79877213-79877235 AAGAACCAGTGCAAATACTCTGG + Intergenic
910369491 1:86501396-86501418 AAAAACTAGAAGAAGTGCTCAGG + Intergenic
912773908 1:112491457-112491479 AAGAACATGTTGAACTGTTCAGG + Intronic
913304202 1:117407761-117407783 AAGATAAAGTAAAAAAGCTCAGG - Intronic
913370469 1:118093483-118093505 AAGAAGAAGAAGAAAGGTTCAGG - Intronic
913384547 1:118245013-118245035 AAGAACCAGGAGAATTGCTTTGG - Intergenic
915177135 1:154025326-154025348 AAGAAGAAGAAGAAACTCTCTGG - Intronic
915545785 1:156596722-156596744 AACAAGAAGAGGAAATGCTCTGG + Intronic
915605366 1:156947028-156947050 GAGAACAAATAGAAATGCCTGGG + Intronic
916227747 1:162506905-162506927 AAGAAAAAGTTAAAATCCTCTGG - Intronic
916706343 1:167354650-167354672 ATAAACCAGTACAAATGCTCTGG - Intronic
916908066 1:169311001-169311023 AAGAACAACTGGAAATGCAGAGG - Intronic
917017605 1:170551340-170551362 AACATCAAGTAGAAAACCTCAGG - Intronic
918230275 1:182523637-182523659 AAGACCAAGCAGAATAGCTCAGG + Intronic
919102720 1:193113508-193113530 AAGAATATGCAGGAATGCTCAGG + Intergenic
919103773 1:193123988-193124010 AAGAATAGGTAGGAATTCTCTGG + Intronic
920159259 1:203983574-203983596 AAGAACAAGCACCAAGGCTCTGG - Intergenic
920250855 1:204621353-204621375 AAGAACAAGTAGGAGTTGTCTGG - Exonic
920842714 1:209568158-209568180 AAGAAAAAGCATACATGCTCTGG - Intergenic
920962294 1:210674242-210674264 AAGAGCAGTTAGAAATGCTTGGG - Intronic
921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG + Intergenic
921791495 1:219295668-219295690 ATAAACTAGTAGAAAGGCTCTGG - Intergenic
923199759 1:231699956-231699978 AAGAGCCAGTACAAAGGCTCAGG - Intronic
923816153 1:237381081-237381103 AAGAAAAAAAAGAAATGATCTGG + Intronic
923843330 1:237698910-237698932 AAGAACATTGAGAAATTCTCAGG + Intronic
924506146 1:244686197-244686219 AAGAATAAGAAGAAAAGCTTAGG + Intronic
1064180867 10:13113394-13113416 AAGAAAGAGCAGAACTGCTCTGG + Intronic
1065382867 10:25107598-25107620 AAGAACAAGCAGGAAGGCTGTGG - Intergenic
1065956073 10:30694614-30694636 AAGAACAATTTGAAAAGCACTGG - Intergenic
1068116320 10:52740912-52740934 AACACCATGTAGACATGCTCAGG - Intergenic
1068207762 10:53879080-53879102 AAGAACAAATAGAAGAGATCAGG - Intronic
1068533427 10:58213707-58213729 AAGAAAAAATAGAAATGGGCTGG + Intronic
1068656914 10:59585343-59585365 AAGAAGAACTAGAAAATCTCTGG - Intergenic
1069107533 10:64401866-64401888 AAGAAAAAGGAGAAAAACTCTGG - Intergenic
1069166739 10:65169503-65169525 AGGAAGAAGTAGACATGCTAGGG - Intergenic
1069240406 10:66131081-66131103 AAGAAGAAGAAGAAAAGCCCTGG + Intronic
1070584519 10:77752158-77752180 AAAAAAAAATAGAAATCCTCAGG + Intergenic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1071945060 10:90634841-90634863 AAGAGCAAGTAAGCATGCTCTGG + Intergenic
1072517448 10:96199547-96199569 AAGGACAAGTAGAAATGAGATGG + Intronic
1073166991 10:101463765-101463787 AGGCACAAGTAGAAACGCTTTGG - Intronic
1073226013 10:101919766-101919788 AAAATCTAGAAGAAATGCTCTGG - Intronic
1073393024 10:103194447-103194469 AAGAAGGGGTAGAAGTGCTCTGG - Intergenic
1074333562 10:112544769-112544791 AAGAGCAAGCACAAAGGCTCTGG + Intronic
1075176591 10:120169023-120169045 CAGAACATGCAGGAATGCTCAGG + Intergenic
1075302281 10:121335591-121335613 AAGAACAAGTGCAAAGGCCCTGG - Intergenic
1075931201 10:126297685-126297707 AAAAACAACTAGAAAAGCTAGGG + Intronic
1076841612 10:133048718-133048740 AAGGACAAGTAGACATGTTCAGG - Intergenic
1077371630 11:2184925-2184947 AGGGAGAAGTAGAGATGCTCGGG - Intergenic
1077979858 11:7288675-7288697 AAGAACAAGTATAAATGAGAAGG - Intronic
1078330209 11:10413072-10413094 AAGAACAAGTATAAAGGTCCTGG - Intronic
1078837441 11:15044533-15044555 AAGAAGAAGCAGAAATGCCCTGG - Intronic
1079800874 11:24867102-24867124 AAGAAAAAGAAGAAAGACTCTGG - Intronic
1085029283 11:73259843-73259865 AAGAACAACTAGAATTGTTTGGG - Intergenic
1086312638 11:85551862-85551884 AGAAAAAAGTAGAAATCCTCAGG + Intronic
1086379458 11:86236988-86237010 AAGAAGAAGAAGAGATGCTGTGG + Intergenic
1087114582 11:94511835-94511857 AAGAGCAAGTAGAAAAATTCAGG - Intergenic
1088274091 11:108065963-108065985 AAGAATAAATACAAATGGTCAGG - Intronic
1089624742 11:119744136-119744158 GAGAGCAAGTAAGAATGCTCAGG + Intergenic
1089726599 11:120486032-120486054 AAAAACAAATGGAAATGCTTCGG + Exonic
1091003188 11:131928378-131928400 AAAAACAAGTTAAAATGCTTAGG + Intronic
1093013824 12:14136236-14136258 AAGAATGTGTAGGAATGCTCAGG + Intergenic
1097837432 12:64287280-64287302 AAGAAGAAGAAGAAGTGCTTGGG + Intronic
1097861023 12:64518794-64518816 AAGAGCAGGTAGATATGCTGAGG - Intergenic
1098067963 12:66640030-66640052 AAGACCAAGTAGAAAATATCAGG - Intronic
1099629615 12:85125435-85125457 AAGAACAAGAAGAAATTGACAGG - Intronic
1100007276 12:89909557-89909579 TAGAACCAGTATAGATGCTCAGG + Intergenic
1100141104 12:91619924-91619946 AAGAAAAATTAGAGATTCTCTGG - Intergenic
1101193952 12:102363508-102363530 AAAAAGGAGGAGAAATGCTCTGG - Intergenic
1104169864 12:126269634-126269656 AAGAACAAGTAGAAGTTTACTGG + Intergenic
1104309131 12:127638063-127638085 AAGAACTAGTAGTTATGCTAAGG + Intergenic
1106082320 13:26510766-26510788 AAAAAAAAAAAGAAATGCTCAGG + Intergenic
1106354522 13:28967445-28967467 AAGAAGAAATAAAAAAGCTCTGG + Intronic
1106923486 13:34589127-34589149 AAGAATAAAAAGAAAAGCTCTGG + Intergenic
1107018971 13:35732075-35732097 AATAAAAAGAAGAAATGCTGTGG - Intergenic
1107176847 13:37409222-37409244 AGGAACAAGGAGAAATGCTAAGG - Intergenic
1108608122 13:52060687-52060709 AAAAACAAGTAGAAAAACTAAGG - Intronic
1109903054 13:68799070-68799092 AAAAACATGTATGAATGCTCAGG + Intergenic
1110647161 13:77900938-77900960 AAGAAAAAGGAAATATGCTCTGG + Intronic
1110661295 13:78061460-78061482 AAGAAGCAGCAGAAAGGCTCTGG - Intergenic
1110675019 13:78232125-78232147 AAGAATAAATAGAAATGTTCTGG - Intergenic
1110940838 13:81345586-81345608 ATGAACAGATTGAAATGCTCTGG - Intergenic
1111449978 13:88402195-88402217 AAGCACATGAAAAAATGCTCAGG - Intergenic
1111632533 13:90860814-90860836 TAGAGCAAGCATAAATGCTCTGG - Intergenic
1111632663 13:90862611-90862633 AACTACAAGTAGAATCGCTCTGG + Intergenic
1112293833 13:98168822-98168844 AAGAAGTAGTTGAAATGTTCAGG + Intronic
1115790942 14:36877570-36877592 AAGAACAAATAGTAATGCATGGG + Intronic
1116942491 14:50804296-50804318 CAGAAAAAGCAGAGATGCTCAGG + Intronic
1116952086 14:50888080-50888102 AAGAACAATTAGAAAAGATGTGG - Intronic
1117134899 14:52725617-52725639 AAGATAAAGGAGAAATGATCAGG - Intronic
1118241004 14:64058989-64059011 AGAATCAAGTAGAAATGCTGGGG - Intronic
1118422994 14:65628147-65628169 AGGATCAAATAGAAAAGCTCTGG + Intronic
1118625939 14:67658987-67659009 AACACAAAGTAGAAATTCTCTGG - Intronic
1119068174 14:71551807-71551829 AAGAGCAAGTGGAAAGACTCTGG - Intronic
1119245639 14:73104219-73104241 AAAAACAAATAAAAATGCTAGGG - Intronic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1121697268 14:95924100-95924122 AAGAACAAGGGGGAAAGCTCGGG + Intergenic
1123966580 15:25465882-25465904 AAGGACAAGCACAAATCCTCAGG - Intergenic
1124170548 15:27368740-27368762 AAGGACAAGTAGACATGCTTGGG + Intronic
1124919515 15:34012390-34012412 AAGATCACCCAGAAATGCTCAGG - Intronic
1125438359 15:39672933-39672955 AAAAACCAGAAGAAATGGTCAGG + Intronic
1126930009 15:53637379-53637401 GACAACAAGTAAAAATGTTCTGG - Intronic
1127376219 15:58387611-58387633 AAGAACATGTAGAGATGCTCAGG + Intronic
1129808675 15:78487397-78487419 AATAAAAAATAAAAATGCTCAGG - Intronic
1130553652 15:84908167-84908189 AAAAAAAAAAAGAAATGCTCTGG - Intronic
1131780671 15:95854789-95854811 GAGAAAAAGGAGAAATGCTATGG + Intergenic
1133312724 16:4860692-4860714 AAGAAGAAGAAGAAATATTCTGG + Exonic
1134101019 16:11451595-11451617 AAACACAGGTAGAAATGCTGAGG + Intronic
1134479814 16:14609026-14609048 AAGGACATGCAGAAATGTTCAGG + Intronic
1135650253 16:24200223-24200245 AAGAACAACCAGAAATGAGCAGG - Intronic
1136403959 16:30032570-30032592 AAGAACCAGTAGAAATCACCTGG - Intronic
1136486147 16:30572865-30572887 AAGAAAAAGTAGAAATGGCTGGG - Intergenic
1137612742 16:49829777-49829799 AAGAACAAGAAGAAATGTGGGGG + Intronic
1137779035 16:51081512-51081534 AGGAAGAAGGAGAAATGCACTGG - Intergenic
1138912040 16:61412826-61412848 AACAACAATTTGTAATGCTCAGG + Intergenic
1140452470 16:75081766-75081788 AAGAACTAGAAGAAATTCTTGGG + Intronic
1144350878 17:14395051-14395073 AGGAACATGTAGAATTGCTTGGG + Intergenic
1144512520 17:15889396-15889418 TAGAAAATGTAGAAATGCGCAGG + Intergenic
1146432614 17:32811902-32811924 AAGGACAAGTCAAAATGCTGAGG + Intronic
1146500409 17:33359545-33359567 GAGGCCAAGTAGCAATGCTCAGG + Intronic
1147239366 17:39080479-39080501 AAGAGCAAGGAGAAAAGCTCTGG + Intronic
1148963245 17:51411155-51411177 ATGGATAAGTAGGAATGCTCTGG + Intergenic
1151623960 17:75265024-75265046 AAGAAAAAGAAGAAAAGCACTGG - Intronic
1155813388 18:30269462-30269484 AAGCACAAGTATAAATTCTGTGG + Intergenic
1157015062 18:43702036-43702058 AAGAAAAAGTAGAAATTTTTTGG + Intergenic
1159157786 18:64606702-64606724 AAGAATAAGCAGAGAAGCTCTGG + Intergenic
1159571914 18:70124195-70124217 AATAACAGGTAGAAATGATCAGG + Intronic
1159906866 18:74100698-74100720 AAGAACAATTAGAAATGAAATGG + Intronic
1161286370 19:3470486-3470508 AACAACAAGTAGAAGTGGCCGGG + Intergenic
1162000317 19:7740614-7740636 AACAACAACTAGAAAAGCTATGG + Exonic
1162188666 19:8927471-8927493 AAGAACATGGAGAAATGATTGGG + Intronic
1162304425 19:9863155-9863177 AACAGCAAGTAGAAAGGCTGAGG + Intronic
1165490443 19:36120305-36120327 CAGAACAGGAAGAGATGCTCTGG + Intronic
1165767949 19:38362370-38362392 AAGAAGAAGTAGTAATCCTGGGG - Exonic
1166598680 19:44073842-44073864 AAGACCAAAAAGAAATGCACCGG - Intronic
1167725136 19:51206718-51206740 AAGAAACAGCAGAGATGCTCAGG + Intergenic
1167765442 19:51479380-51479402 AAAGACATGTAGAAATTCTCGGG + Intronic
1168364838 19:55777390-55777412 AAGTACAAATATAAATGATCAGG - Intergenic
925055830 2:856666-856688 AAGGAAAAGAAGGAATGCTCAGG + Intergenic
925249162 2:2415859-2415881 AAGATCACGAAGAAATGCACTGG - Intergenic
925511543 2:4631660-4631682 AAGAACAAGTAACAATGTACTGG + Intergenic
926660398 2:15459489-15459511 AAAAAAAAGAAAAAATGCTCAGG - Intronic
927233044 2:20844047-20844069 AAGAACATGTAGAAATCATTTGG + Intergenic
927456889 2:23260652-23260674 AAAAGCTACTAGAAATGCTCAGG - Intergenic
927585368 2:24298710-24298732 GAGAACAAGAAGAAATTGTCAGG - Exonic
927613706 2:24567329-24567351 AAAAACAAGTAAAATGGCTCTGG - Intronic
928059170 2:28092794-28092816 AAGAATAAGTACAAATGATCAGG - Intronic
928802895 2:35115664-35115686 AATAACAAGTAGCAATGCCCAGG + Intergenic
928956089 2:36869443-36869465 AAGAACTAGAAGAAATGTTTGGG + Intronic
930280784 2:49367440-49367462 CAGAACAAGAAGACAGGCTCAGG + Intergenic
930984754 2:57571563-57571585 TAGAACATGTAGACATGTTCAGG - Intergenic
931565338 2:63610174-63610196 AAGTACTAGTAAAAATGCTTAGG - Intronic
932574036 2:72953058-72953080 AAGAACATGTACACATGCCCGGG - Intronic
934042011 2:88135290-88135312 AAGAGCAAGAAGAAATTTTCTGG + Intergenic
934685060 2:96315182-96315204 AAGAACATGCAGGCATGCTCTGG - Intergenic
935722692 2:105993532-105993554 AAGAGCAACTATAAATCCTCTGG - Intergenic
936958480 2:118047955-118047977 AATGCCAAGTAGAAATGCTTGGG - Intergenic
937159797 2:119749472-119749494 GAGAATAAGTACAAGTGCTCTGG - Intergenic
937808165 2:126169807-126169829 AAAAAAAATTAGAATTGCTCTGG + Intergenic
939196523 2:138979827-138979849 AAGAAAAAGTAAATATACTCAGG + Intergenic
940937349 2:159511717-159511739 ATGACTAAGTAGAAATGCTCAGG + Intronic
941108384 2:161389425-161389447 ATCAAAAAGTAGAAATGATCAGG - Intronic
941226858 2:162860652-162860674 AAGAAAATGTACACATGCTCAGG + Intergenic
942564644 2:177254430-177254452 AAGAACAAGCAGCAATGTCCTGG + Intronic
943043684 2:182832696-182832718 AAGAACAAAGAGAAAGGCTGGGG + Intergenic
943326667 2:186507186-186507208 AAGTAAAAGAAGAAATGCTTAGG + Intronic
943536667 2:189160780-189160802 AAGTACATGAAGAAATTCTCAGG - Intronic
943829182 2:192437095-192437117 AAGCATATGAAGAAATGCTCAGG - Intergenic
945138145 2:206652290-206652312 AACAATAAATATAAATGCTCAGG - Intronic
945365809 2:208952123-208952145 AATATCCAGTAGAAATGCTTTGG - Intergenic
947020336 2:225667477-225667499 AAGAGCATGTGGTAATGCTCTGG + Intergenic
1169564514 20:6839098-6839120 AAACACCAGTAGAAATTCTCAGG + Intergenic
1169677651 20:8172704-8172726 AAGAACAAAGAAAAATGTTCAGG - Intronic
1171162809 20:22943668-22943690 AAGAACATTTAGAAATTCTCAGG - Intergenic
1172314110 20:33940177-33940199 AAGAAAATGTAAAAATGATCAGG - Intergenic
1174279462 20:49428256-49428278 AAGCAGAAGTAGAAATTCTATGG + Intronic
1179019730 21:37627619-37627641 AAGAACAAAAAGAAATTCTGGGG + Intronic
1179160942 21:38898459-38898481 AAGAACATGTAGGAATGGTCAGG + Intergenic
1179460933 21:41534626-41534648 AAAAACAGACAGAAATGCTCAGG - Intergenic
1181616531 22:24058689-24058711 AAGAACAGGTACAAAGGCACAGG - Intronic
1182291629 22:29284415-29284437 AGGAACAAGTAGAATTGATTGGG + Intronic
1182719991 22:32389858-32389880 AAGCAAAAGTCCAAATGCTCTGG + Intronic
1182931598 22:34179606-34179628 AATAACAAGTAGAAATTCAGGGG + Intergenic
1184325354 22:43778982-43779004 ATGACCAGGTAGAAATGATCAGG + Intronic
949922268 3:9012358-9012380 AAGAAATAGTAGAAATGCTTTGG + Intronic
951102298 3:18703231-18703253 AATAACCAGCAGAAATACTCAGG + Intergenic
951466527 3:23005901-23005923 AACAACAAAAAGAAAGGCTCGGG - Intergenic
951501652 3:23394516-23394538 AAGAACAACTAGAAAAACTGAGG + Intronic
951932219 3:27981397-27981419 AAAAACTAGAAGAAATGATCTGG + Intergenic
952053566 3:29415997-29416019 AAGAACAAGTGGAAACGCATAGG + Intronic
952207261 3:31192208-31192230 AAGAACTGGTAGAAAAGATCTGG - Intergenic
952821657 3:37491445-37491467 GAGACCAAGTAGACATGCCCAGG + Intronic
954746892 3:52792470-52792492 AAGAAAAAGCAGAAAGCCTCTGG - Intergenic
956324574 3:68037192-68037214 AAGAACAAGTAGAAAGGCAATGG + Intronic
956338690 3:68195127-68195149 AAGAACATTTCCAAATGCTCTGG - Intronic
960235831 3:115280967-115280989 AAGAACAAGTAGTAAGAATCAGG - Intergenic
961488906 3:127237474-127237496 AAACACAAGCAGAAATGTTCTGG - Intergenic
962089584 3:132229315-132229337 GAGAATGAGTATAAATGCTCTGG - Intronic
962841958 3:139241563-139241585 AAGAACATATAGAAATGTTTAGG - Intronic
963172638 3:142266488-142266510 AAGAAAAAAAAGAAATGCTATGG + Intergenic
963411306 3:144931427-144931449 AATAACCAGTAGCAATACTCAGG + Intergenic
964493147 3:157258569-157258591 AAGAACTAGTAGGATTGCTGTGG - Intergenic
964695214 3:159500282-159500304 AAGAACAATTTGAAATGCCCTGG - Intronic
964794714 3:160484197-160484219 AATAGCTAGTAGAAATGCTATGG + Intronic
964869430 3:161297030-161297052 ACAATCAAATAGAAATGCTCTGG - Intergenic
964871678 3:161319637-161319659 AATAACCAGCAGCAATGCTCAGG + Intergenic
965796987 3:172449552-172449574 AAGAAAAAGACGTAATGCTCAGG - Intergenic
965921234 3:173916856-173916878 AAGAACAAATTGAAATTTTCTGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967140817 3:186557898-186557920 AAGAACAAGTAAAAATATTTTGG + Intronic
968385170 4:129806-129828 AAGAACAAATAGAAATGCTGGGG + Intronic
972066066 4:34945646-34945668 AAGAACAAAGAGAAATGCCCAGG - Intergenic
972654957 4:41055354-41055376 TAGAACAAATAGAAGTGCTATGG + Intronic
974627463 4:64443140-64443162 AAGAAAAAGTGGAAATGGTAAGG - Intergenic
974975689 4:68888292-68888314 GGGAACATGTAGAAATGCTTAGG + Intergenic
975905836 4:79210775-79210797 AAAAAGAAGAAGAAAGGCTCTGG + Intergenic
976104651 4:81603816-81603838 TAGAACAAGTAGGAATTCACAGG - Intronic
976572277 4:86626173-86626195 AAGAATAAGAAGAAAAACTCTGG - Intronic
976860154 4:89655485-89655507 AAAAACAAGTAGAAATAGCCGGG + Intergenic
976912967 4:90331232-90331254 AAGTAACAGTAGAAATGCTCAGG + Intronic
977734582 4:100398432-100398454 AAGAAGAAATAGAGATGCTGGGG + Intronic
978212674 4:106157007-106157029 AATAACCAGTAGAAATACCCAGG - Intronic
979679463 4:123443904-123443926 AAGAACAAGTGAAAAGACTCTGG + Intergenic
980019055 4:127686547-127686569 AAGAAAAAGTACAAAAGCCCTGG - Intronic
982606171 4:157518909-157518931 AATAACAAGTAGAAATGACAGGG - Intergenic
982655748 4:158147699-158147721 AAAAACAAGTAAAACTCCTCTGG + Intronic
983743657 4:171167374-171167396 AAGAACAGGTAGGTAGGCTCAGG + Intergenic
984270716 4:177545557-177545579 AAGAACAGGTAGAGATGGGCAGG + Intergenic
986593470 5:9395581-9395603 TATACCAAGAAGAAATGCTCAGG + Intronic
987531422 5:19126082-19126104 AACAACAAGGAGACATGCTAAGG - Intergenic
987700142 5:21387399-21387421 AAGAACAAGTAGAGATTTGCGGG + Intergenic
987770662 5:22299384-22299406 AAGATCAAGTAGAAATGTTTTGG + Intronic
987875933 5:23681137-23681159 AAGAGCAAGTGGAAATTATCTGG + Intergenic
988139331 5:27215796-27215818 AAGAAAAAGTAGATAGGATCAGG + Intergenic
988292775 5:29311214-29311236 TAGAAAAAGTAGAAATGGTAGGG + Intergenic
988293849 5:29329335-29329357 CAGTATAAGTAGAAATGCTTTGG + Intergenic
988809308 5:34768670-34768692 AAGAAAAAGAGCAAATGCTCTGG + Intronic
990716342 5:58641479-58641501 AAAAACCAGGAGAAATGCTAAGG + Intronic
991249556 5:64544751-64544773 AAGAACATATACAAAGGCTCTGG + Intronic
991380222 5:66014276-66014298 AAGAAGGAGGAGAAATCCTCTGG - Intronic
992799462 5:80282472-80282494 CAGAACAAAAAGAAATGCTGTGG + Intergenic
993539427 5:89130234-89130256 AAGAACAATTACAATTGCTGTGG - Intergenic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994313194 5:98300767-98300789 AAAAAGAAGTAGAAAACCTCTGG - Intergenic
995170036 5:109097580-109097602 AAGAACAAGTTGAAAAGGACAGG + Intronic
995319769 5:110820514-110820536 AAGGGCAAGCAGTAATGCTCAGG - Intergenic
995345244 5:111106901-111106923 TAGAACAAGTAGAAATTACCTGG - Intronic
995717722 5:115096710-115096732 AAGAAAAAAAAGAAATGCTAAGG - Intergenic
995762895 5:115582713-115582735 AAGAACAAGTAGAAATGCTCTGG - Intronic
996249901 5:121316981-121317003 AAGAACAAGTACAAGAACTCTGG - Intergenic
998526711 5:142849353-142849375 AAATACAAATGGAAATGCTCTGG - Intronic
999714437 5:154348606-154348628 GAGAACAAGTAGACAAGCTTTGG + Intronic
1000527415 5:162375023-162375045 AACAACAAATAAAAACGCTCAGG - Intergenic
1001024509 5:168212726-168212748 AAAAATGAGTAGAAATGCCCTGG + Intronic
1003528602 6:6918937-6918959 ATGGACAAGTAGGAATGCTTTGG - Intergenic
1003964342 6:11238779-11238801 AGAAACAATTAGAAATGCTTAGG + Intronic
1003981788 6:11396801-11396823 AATAACAAGCACAAATGCCCTGG + Intergenic
1004031735 6:11876889-11876911 AAGGACATGAGGAAATGCTCTGG + Intergenic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1007586354 6:42992424-42992446 TAGATCAATTAGAAAGGCTCTGG - Intronic
1007732554 6:43956439-43956461 AAGAACAAGGAAAAATGAACAGG + Intergenic
1008304366 6:49884047-49884069 AAGAAAAAAAAGAAATGCTAAGG - Intergenic
1008895792 6:56553255-56553277 AAGAGCAAGTAGAGACTCTCTGG - Exonic
1009198221 6:60712556-60712578 AGGAGCAAGTAGCAATGGTCTGG - Intergenic
1009894382 6:69728917-69728939 GGGAACAAGTAGAATTGCTCTGG - Intronic
1010149515 6:72714103-72714125 AAGAACAATTACAACTGCTGTGG + Intronic
1010740835 6:79502177-79502199 AAGTACAATGAGAAAAGCTCTGG + Intronic
1012047693 6:94300112-94300134 AATAACAAGTAGAAAAACTGAGG + Intergenic
1012251907 6:96990178-96990200 AAGAACTAGTACAAAAACTCTGG - Intronic
1013281112 6:108637868-108637890 AAGAACATCTTGAAATCCTCAGG + Intronic
1013959244 6:115879068-115879090 ATGAACAAATAGAAATGGTTTGG - Intergenic
1013968500 6:115985672-115985694 TAAAACATGTAGAAATGTTCAGG + Intronic
1015017622 6:128433470-128433492 AAAAACTATTAGAAATGCCCTGG - Intronic
1015359563 6:132323093-132323115 GATAACATGTAGAAATGGTCTGG - Intronic
1017353365 6:153471702-153471724 AAGAAAATGTAAAAATGTTCAGG - Intergenic
1018073635 6:160190051-160190073 AAGAAAAAGTATACTTGCTCTGG + Intronic
1020047717 7:5055075-5055097 AAGAAAAAGTAAAAGTGCTCGGG - Intronic
1020382734 7:7564905-7564927 AAGAACCAGTAGAAATGGAGAGG + Intergenic
1021155978 7:17210344-17210366 CAGAAAAGGTAGAAATACTCTGG - Intergenic
1021812724 7:24419064-24419086 CAGATCTGGTAGAAATGCTCTGG + Intergenic
1022150650 7:27600684-27600706 AAGAACAAGTTGAAATGAAAAGG + Intronic
1022267356 7:28770386-28770408 AAGAGAATGTGGAAATGCTCTGG - Intronic
1022400414 7:30030809-30030831 AAGAACAAGTAGAAAAGTGGAGG - Intronic
1023521936 7:41058137-41058159 AAGAACAAGAAAAAATCATCAGG - Intergenic
1024116651 7:46200520-46200542 AACACCAAAGAGAAATGCTCCGG - Intergenic
1024172724 7:46807072-46807094 GAGAACAAGAATAAATGTTCTGG - Intergenic
1024194255 7:47043291-47043313 CAGAACTAGGAGAATTGCTCAGG - Intergenic
1026030835 7:66792434-66792456 AAGCACAAATGCAAATGCTCTGG - Intronic
1026252085 7:68679815-68679837 AAGTCCAAGTAGGCATGCTCGGG - Intergenic
1026328681 7:69333343-69333365 AAGCAGAAGTAGAAAGGATCGGG + Intergenic
1026628979 7:72021333-72021355 AAGAAGAAGGAGAAACGCCCAGG + Intronic
1026728228 7:72888503-72888525 AAGAAAAAGTAAAAGTGCTTGGG - Intronic
1027112273 7:75449709-75449731 AAGAACAGGAAGAAATGCCAGGG + Intronic
1027115603 7:75477285-75477307 AAGAAAAAGTAAAAGTGCTTGGG + Intronic
1027120797 7:75518359-75518381 AAGGAAAAGTAAAAGTGCTCGGG + Intergenic
1027221862 7:76219333-76219355 GAGAACAGGTAACAATGCTCAGG - Intronic
1027519767 7:79191364-79191386 GAAAAAAAGAAGAAATGCTCAGG - Intronic
1027528308 7:79299231-79299253 AAGATTAAGTAGAAATTTTCCGG + Intronic
1027682350 7:81236960-81236982 AAGAACATGAAGAAAGGCTTTGG - Intergenic
1028270957 7:88788383-88788405 AACAACAAGTGTAAAGGCTCTGG - Intronic
1028579638 7:92394778-92394800 AAGAACCAGTATAAACCCTCAGG + Intronic
1029721991 7:102373656-102373678 AAGGAAAAGTAAAAGTGCTCGGG - Intronic
1030857380 7:114577550-114577572 AAGAACAGTTTGTAATGCTCAGG + Intronic
1031142007 7:117952939-117952961 AAGAATAAGTTTAAATGCTTTGG + Intergenic
1033006124 7:137565473-137565495 AAGGACATGGAGAAATTCTCAGG - Intronic
1035828180 8:2667036-2667058 AAGAACAATTTGAAATGTTTAGG - Intergenic
1036081453 8:5561081-5561103 AACCACAAGTAAAAGTGCTCTGG + Intergenic
1038384837 8:27133865-27133887 AAAAACAACTAGAAAGGCTGTGG - Intergenic
1038922103 8:32096047-32096069 AATAGCAAGCACAAATGCTCAGG + Intronic
1041253610 8:55959267-55959289 AAGAAGATGTAGAAATGACCAGG - Intronic
1042425033 8:68637780-68637802 AAGTTCAAGTGGAAATGCTTTGG + Intronic
1042645631 8:70983247-70983269 AAGAACAAATAGGAATAGTCAGG - Intergenic
1043052994 8:75405385-75405407 AACAATAAGAAGAAAGGCTCAGG - Intergenic
1043298307 8:78694635-78694657 ATTAACAACTAAAAATGCTCAGG - Intronic
1044371356 8:91415199-91415221 AAGAACATGCAGGGATGCTCAGG - Intergenic
1045586358 8:103541502-103541524 AAGAAAAAAAAGAAATGCTAAGG + Intronic
1046125095 8:109896659-109896681 AAGAACATTTAGAAATGATCAGG - Intergenic
1046631182 8:116624490-116624512 AAGAGCAAGTACAAATATTCTGG - Intergenic
1046815227 8:118575978-118576000 AAAAAAAAGTCGAAATACTCAGG - Intronic
1047158036 8:122343769-122343791 AAGATCAAGAAGAAAAGCTTGGG + Intergenic
1047520241 8:125590453-125590475 AAGAAAAAATAGGTATGCTCAGG - Intergenic
1047619325 8:126590309-126590331 AAGAACAGGTAAAAAGACTCAGG + Intergenic
1049226353 8:141452444-141452466 AAGCACATGAAGAGATGCTCAGG + Intergenic
1050305984 9:4306486-4306508 GAGAACATGTAGAAATGGCCTGG - Intronic
1050406942 9:5319352-5319374 AAGAACAAGACGAATGGCTCAGG + Intergenic
1050829924 9:9998151-9998173 AAGAAGAAGAAGGAATGCCCAGG + Intronic
1051138021 9:13945611-13945633 AGAAACAAGGAGAAATGGTCAGG - Intergenic
1052111315 9:24586516-24586538 ATGAAAAATTAGCAATGCTCTGG - Intergenic
1052248104 9:26362643-26362665 AAGTTCAAGTTGAAATTCTCAGG + Intergenic
1052248283 9:26365203-26365225 AAGGACAAGTAGAGATGAGCCGG + Intergenic
1052263162 9:26540849-26540871 AAGAACAAGCAGAAAAACTTTGG + Intergenic
1053242464 9:36507224-36507246 AAGAAGAAGAAGAAATGCCCTGG - Intergenic
1053406288 9:37879141-37879163 AAGGACCAGAAGAAATGCTGAGG + Intronic
1053514833 9:38722000-38722022 AGGAGAAAGAAGAAATGCTCGGG - Intergenic
1055216077 9:73863938-73863960 GAGAACAAATAGAAAAGCTGGGG - Intergenic
1056445171 9:86658605-86658627 AAGAACATGTAAAAATGGCCGGG - Intergenic
1056459648 9:86797362-86797384 AAGAACAAGTAGAAGTTCAGAGG - Intergenic
1056842926 9:90013385-90013407 AAGCACAAGCAGAAATGCACGGG - Intergenic
1057528839 9:95826410-95826432 TAGAACAAGAAGAAATATTCTGG - Intergenic
1058671110 9:107361300-107361322 AAAAGAAAGTAGAAATGCTTAGG - Intergenic
1058683580 9:107461308-107461330 ATAAAAAAGTAGAAATGCTGAGG + Intergenic
1061361117 9:130142978-130143000 CAGAACAAGCAGAAATCCCCCGG - Intergenic
1187194871 X:17073326-17073348 AGGAACCAGTAGCTATGCTCAGG - Intronic
1187912650 X:24125074-24125096 AAGAACAAGCAGGAACTCTCTGG - Intergenic
1187920943 X:24200867-24200889 AAAAAAATGTAGAAATGCTAAGG + Intronic
1189199328 X:39178173-39178195 AACAGCAAGTGGAAAGGCTCTGG - Intergenic
1189890065 X:45591771-45591793 AATAACAAGCAGCAATACTCAGG - Intergenic
1189975364 X:46456416-46456438 AAGCAAAAGTATAAATCCTCTGG + Intronic
1190272376 X:48876062-48876084 AAGAAGAAATAGAAATTCTTTGG + Intergenic
1192301960 X:69914438-69914460 AGTAACATGTGGAAATGCTCTGG - Intronic
1194558595 X:95393520-95393542 AAGAACAAGCAGCAATACTCAGG + Intergenic
1194784157 X:98061784-98061806 AAGAAAAAGTACACATGATCGGG + Intergenic
1197324671 X:125077684-125077706 AGGAAAAATTAGAAATGATCAGG + Intergenic
1197669248 X:129257792-129257814 AAGAAAATGTTGAAATGCTTTGG + Intergenic
1198613998 X:138434097-138434119 AAGAAGAAATAAAAAGGCTCAGG - Intergenic
1199171801 X:144741855-144741877 AAGAAAAAGTCCAAATGCTAGGG + Intergenic
1199924571 X:152449431-152449453 CAGAACAACTCCAAATGCTCAGG + Intronic
1200422286 Y:2984553-2984575 AAGAATAAGTAAAATTGCCCCGG + Intergenic
1201751155 Y:17433329-17433351 AACAACCATGAGAAATGCTCCGG - Intergenic