ID: 995764458

View in Genome Browser
Species Human (GRCh38)
Location 5:115600969-115600991
Sequence ATGTTTACACTGTTGAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995764458_995764460 2 Left 995764458 5:115600969-115600991 CCATGATTCAACAGTGTAAACAT 0: 1
1: 0
2: 0
3: 18
4: 214
Right 995764460 5:115600994-115601016 TTTATACTTCAAGTTCCATACGG No data
995764458_995764461 7 Left 995764458 5:115600969-115600991 CCATGATTCAACAGTGTAAACAT 0: 1
1: 0
2: 0
3: 18
4: 214
Right 995764461 5:115600999-115601021 ACTTCAAGTTCCATACGGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995764458 Original CRISPR ATGTTTACACTGTTGAATCA TGG (reversed) Intronic
902925548 1:19693632-19693654 ATGTTTAAAATGTGGACTCATGG + Intronic
904387068 1:30150180-30150202 ATGTTTATACTTTTAAATCATGG - Intergenic
909533367 1:76706497-76706519 ATGTATGCACTGTTTCATCATGG - Intergenic
910853589 1:91672082-91672104 ATGTTTCCACTGTGTAATAAAGG + Intergenic
911157817 1:94654059-94654081 ATATTTACCCTGTTTAATCATGG + Intergenic
913279127 1:117169011-117169033 ATGTCTACACTGGAGAAGCATGG + Intronic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
914399927 1:147309120-147309142 ATGTATACTCTGTTGATTTAGGG - Intergenic
917393997 1:174571839-174571861 ATGTTTACACTGCTTCAACACGG + Intronic
921175634 1:212591652-212591674 ATTTTTAAACTTTTTAATCATGG + Intronic
922063046 1:222109841-222109863 ATGATGACACTGTTGGCTCAGGG - Intergenic
922115945 1:222614996-222615018 ATGTATTTACTGTTGAATGAGGG - Intergenic
923122774 1:231008905-231008927 ATCTTTACACTGTGAACTCATGG + Intergenic
924130691 1:240904810-240904832 ATTTTTAAAATGTTGAATAAGGG + Intronic
924833012 1:247617189-247617211 AAGTTTATATTTTTGAATCAGGG + Intergenic
1064079924 10:12300133-12300155 GTGTTTACAGTTTTGAATAACGG - Intergenic
1066600093 10:37095245-37095267 TGATTTACGCTGTTGAATCAGGG - Intergenic
1068341826 10:55714202-55714224 AAGTTTACAATGTTCTATCAAGG - Intergenic
1071287224 10:84160100-84160122 ATGTACACAGTGTGGAATCATGG - Intergenic
1072268424 10:93752454-93752476 ATGTTCTAACTGTGGAATCAGGG - Intergenic
1073168087 10:101475979-101476001 ATGTTTATACTGGAGAATCTTGG + Intronic
1074731895 10:116387543-116387565 ATATTTACACTGTTTGATTACGG + Intergenic
1078076602 11:8168010-8168032 ATGTTTAAACTGTTGATTGCTGG - Intronic
1078959141 11:16243110-16243132 ATGTTTGAAGTGATGAATCAAGG - Intronic
1082150828 11:48736557-48736579 ATGTATACTCTGTTGATTTAGGG - Intergenic
1084841714 11:71856941-71856963 ATATTTAAACTTCTGAATCATGG - Intergenic
1085125095 11:73995624-73995646 GTGCTTACAATGTTGAATGATGG - Intergenic
1090447019 11:126773245-126773267 AGGTTAACACTCTTGAATCAGGG + Intronic
1091946648 12:4550993-4551015 ATCTTTACAATGTTGAATTCAGG + Intronic
1092303142 12:7271820-7271842 ATGTATACATAGTTGAATTATGG - Intergenic
1093464616 12:19437242-19437264 ATGTCCACTCTGTTGAATCTAGG + Intronic
1094248853 12:28335897-28335919 ATGTAGACAGTGTTGCATCATGG + Intronic
1094727836 12:33140527-33140549 GTGTTTACATTGTTGAATAAAGG - Intergenic
1095393483 12:41736866-41736888 CTTTTTTCACTGTTCAATCAAGG + Intergenic
1095437491 12:42206928-42206950 ATGTTAACAATTTTGAATCTGGG - Intronic
1095921595 12:47537120-47537142 ATTTTTACACTTGTGAAACAAGG + Intergenic
1097643646 12:62210439-62210461 ATTTTGACAATGTTGAATGAAGG - Intronic
1099486003 12:83230299-83230321 ATGTATACTCTGTTGATTTAGGG + Intergenic
1100052595 12:90467752-90467774 CTCTTAACACTGTTGCATCAGGG + Intergenic
1105451355 13:20502777-20502799 AAGTTTACACTGGAGTATCAAGG + Intronic
1108131578 13:47307151-47307173 ATGTTTACACTGTTGAGCCTTGG - Intergenic
1108140761 13:47418721-47418743 ATGGCTACTCTGTGGAATCAGGG - Intergenic
1108527888 13:51301257-51301279 ATGTAAACACTGTGGAATCTGGG - Intergenic
1110499019 13:76204347-76204369 AAGTTTACACTGAACAATCAAGG + Intergenic
1111269200 13:85858335-85858357 AAGTTTACAATTTTGATTCAAGG + Intergenic
1111290371 13:86160175-86160197 ATGTTGTCACTGTAGAAACATGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1115375824 14:32674157-32674179 ATGTTTAAAGTGTTGAAATAAGG + Intronic
1115456005 14:33602952-33602974 AATTTTACATTGTTGGATCATGG - Intronic
1116589513 14:46753337-46753359 AAGTTTACACTGTTAAGACAGGG - Intergenic
1116873592 14:50090551-50090573 AGGTTTTCACTGTTGAATGAAGG - Intronic
1118236141 14:64007156-64007178 ATTTTGGCACTGTTGATTCACGG - Exonic
1118307950 14:64671105-64671127 ATATATACACTGTTCTATCAGGG - Intergenic
1119057214 14:71435116-71435138 ATGTATACAATGTTTAAGCAGGG - Intronic
1119236320 14:73022712-73022734 ATGTTTATACTTTTGAATGAAGG - Intronic
1120684369 14:87521171-87521193 ATGTCTATCCTGCTGAATCAAGG - Intergenic
1121896112 14:97649394-97649416 GTGTCTACTCTGTTGAATTAAGG + Intergenic
1121933399 14:97994121-97994143 ATGTAGACACTGTTGATTCAAGG - Intergenic
1124336146 15:28858559-28858581 ATCCTAACACTGTTGAATCAAGG + Intergenic
1124855916 15:33388785-33388807 ATGTTTACACTTTTATAGCATGG - Intronic
1129144838 15:73637279-73637301 ATGATTATAATGATGAATCATGG - Intergenic
1134909578 16:18012457-18012479 TTGTTTTTACTGTTGAATCTTGG + Intergenic
1141208358 16:81953351-81953373 ATGTTAACACTGTGGAGTCTAGG + Intronic
1145819990 17:27824861-27824883 ATGTATACAATGTTTAAGCAGGG + Intronic
1148986017 17:51622090-51622112 ATTTTTACACTCTTGACCCACGG + Intergenic
1149067116 17:52494081-52494103 ATGCTGACACTGTTGGTTCATGG + Intergenic
1149398846 17:56272972-56272994 ATATTTGGGCTGTTGAATCAGGG - Intronic
1152983434 18:300559-300581 ATTTTAACACTGTGGACTCATGG + Intergenic
1153527040 18:6006853-6006875 ATGTAAACAGTGTTGAATCAGGG + Intronic
1154416060 18:14176293-14176315 ATGTTTTCACTGTTCAACCTAGG - Intergenic
1155678961 18:28466202-28466224 CTGTTTACACTGGTGAATGAGGG - Intergenic
1157155173 18:45258352-45258374 ATGTTTTCACTGTTGCAACAGGG - Intronic
1157991317 18:52499807-52499829 ATGTTTGCACTAGTGACTCATGG + Intronic
1158797832 18:60869794-60869816 TTCTTTACACTGTTAATTCATGG - Intergenic
1160115159 18:76072376-76072398 AGCTTTACACTCTTGAATCTAGG + Intergenic
1162005366 19:7774897-7774919 ATGTTAACCCTGTTGAGGCACGG + Intergenic
1162612974 19:11770521-11770543 ATGGTTTCACTGTTGAATTCTGG - Intronic
1165219999 19:34307966-34307988 ATCTTTACACAGTTGCATCTTGG + Intronic
1168180734 19:54661480-54661502 ATGTATACACTGTGGAATGATGG + Intronic
1168604182 19:57745026-57745048 ATGGTTAGACTGGTTAATCAAGG + Intronic
925937251 2:8776631-8776653 ATGTTTACATTGCTGAATACTGG - Intronic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
928564392 2:32529092-32529114 AGCTTTACATTGTTGATTCATGG + Intronic
930388185 2:50724451-50724473 ATTATTACAATTTTGAATCATGG - Intronic
930792766 2:55351689-55351711 ATGTTCACAATGTTGAATGTTGG + Intronic
931893870 2:66707022-66707044 ATGTTGAAACTGTGGAATCTTGG - Intergenic
935023580 2:99255180-99255202 ATGTCTACTCTGTTGAAGCCAGG - Intronic
935231231 2:101098541-101098563 ATGTATACACTGTTGATTTGGGG - Intronic
938170608 2:129072323-129072345 CTGTTTACAAAGTTGAATAAAGG - Intergenic
939966178 2:148612515-148612537 TTGTTTACAGTGATGAATCCTGG + Intergenic
940114108 2:150189035-150189057 ATTTTTAAACTGTTACATCATGG - Intergenic
940561193 2:155299543-155299565 TTGTATACACTCTTGATTCAGGG + Intergenic
940619355 2:156091588-156091610 ATGATTACAAAGATGAATCATGG - Intergenic
941571377 2:167175046-167175068 ATGTATACACTGTTGATTTGGGG + Intronic
941669500 2:168277180-168277202 GTGTTTACATTGTTCAAGCAAGG + Intergenic
941698287 2:168576653-168576675 ATGTTAACAGTGGTGAATCTGGG - Intronic
943095133 2:183419116-183419138 ATGTATATTCTGTTGATTCAGGG - Intergenic
943759040 2:191588549-191588571 TTGTTTACAATATTGAATAATGG + Intergenic
943820076 2:192311237-192311259 ATGTTTCCACTGTGCAATGAGGG + Intergenic
945517525 2:210781103-210781125 ATGTTTACAATGTTCAGCCATGG + Intergenic
946502520 2:220264638-220264660 ATGTTTAAACTATTGCATTATGG - Intergenic
946618394 2:221534054-221534076 ATATTTAATCTGTTGAATCTAGG + Intronic
1169594091 20:7178039-7178061 TTTTTTAGACTTTTGAATCATGG + Intergenic
1170658342 20:18312410-18312432 ATGTTTACACTGATAAAATAAGG + Intronic
1172963441 20:38815474-38815496 ATATATACACTGTTCAAACAAGG - Intronic
1174658051 20:52188188-52188210 TTGATTGCAGTGTTGAATCAGGG - Intronic
1176857282 21:13983002-13983024 ATGTTTTCACTGTTCAAACTAGG + Intergenic
1176867328 21:14061229-14061251 ATGTTTTCACTGTTCAAACTAGG - Intergenic
1178194248 21:30324908-30324930 ATGTATCCACTGTTGAAACCGGG + Intergenic
1181121724 22:20671486-20671508 ATGTTTACATTATGAAATCAAGG + Intergenic
1182054607 22:27340169-27340191 ATCTTTACAGTGTGGAATGATGG + Intergenic
1182703567 22:32260409-32260431 ATGCTAACACTGTTGAAACCAGG + Intergenic
1184581374 22:45420070-45420092 ATGTTTACTCTGTAGGATAAGGG - Intronic
949566874 3:5253248-5253270 ATGACTACAGTGTTGAATCCAGG + Intergenic
949746220 3:7295339-7295361 AAGTATAGACTGTTGAATCAAGG - Intronic
951799635 3:26581254-26581276 AGGTTGAGACAGTTGAATCATGG - Intergenic
954263461 3:49456395-49456417 GTCTTGACACTGTTGAATTATGG - Intergenic
954950268 3:54466334-54466356 ATTTTTACACTGTTAAATTCAGG + Intronic
957007485 3:74967179-74967201 ATAATTACATTGTTAAATCACGG - Intergenic
960947531 3:122977073-122977095 ATGGTTACACTGTGCAGTCAGGG + Intronic
961061492 3:123832558-123832580 CTCTTAACACTGTTGCATCAGGG - Intronic
963599204 3:147362989-147363011 ATAATTACACTGTTCAAACATGG - Intergenic
963852741 3:150224418-150224440 ATCTTGACAGTGTTGAGTCAGGG + Intergenic
964813671 3:160693703-160693725 ATGATTTCACTGATGAATCTGGG + Intergenic
966166334 3:177021404-177021426 ACGTTGACAGTGTTGAAGCAGGG - Exonic
968004077 3:195227343-195227365 TTGTTCACACTGTTGGATGAGGG - Intronic
969782815 4:9422974-9422996 ATATTTAAACTTCTGAATCATGG - Intergenic
970941865 4:21643505-21643527 ATGTTAACACGGTTAAATGATGG + Intronic
972006770 4:34119391-34119413 ATTTTTAGAGTGTTTAATCAGGG - Intergenic
973272140 4:48271953-48271975 TTGTTTTCCCTGTTAAATCAGGG - Intergenic
973283287 4:48385039-48385061 AGGTTGAGACTGTTGAATTAAGG + Intronic
973347773 4:49075010-49075032 ATGTATATTCTGTTGATTCAGGG - Intergenic
975822807 4:78289094-78289116 ATGTTCACTATGTTGAATAAAGG + Intronic
976971702 4:91111150-91111172 ATGTTTATGCTGTTGCATTATGG + Intronic
978115128 4:105010552-105010574 ATGTATATACTGTTGAATTTGGG + Intergenic
978319036 4:107473012-107473034 ATGTTTACATTGTCTAATAAAGG + Intergenic
979560623 4:122097521-122097543 ATGTTTACAAAATTGAAACAGGG - Intergenic
980069145 4:128224450-128224472 AGCTTTACACAGTTGATTCAGGG + Intergenic
980635002 4:135490946-135490968 ATATTTACATTGTTGATACAAGG - Intergenic
980663863 4:135902750-135902772 ATATTTACACTTTTAAATGAAGG - Intergenic
982708243 4:158734005-158734027 ATGTATACATTGTGGAATGATGG - Intergenic
982945935 4:161622273-161622295 AGGTTTACACTGGTGAATCCTGG + Intronic
983942806 4:173553769-173553791 ATGTTTTCATTCTTGAATGAAGG - Intergenic
983954501 4:173681508-173681530 ATGTATACAGTGTGGAATGACGG + Intergenic
984313751 4:178099237-178099259 ATTTTTCAACTGCTGAATCAAGG - Intergenic
986527249 5:8693299-8693321 AATTTTAAACTATTGAATCATGG + Intergenic
986672642 5:10156763-10156785 ATGTTTTCCCTGTTGAGTCTTGG - Intergenic
987895442 5:23940369-23940391 ATCTTTAGCCTGATGAATCAAGG - Intergenic
988049883 5:26014154-26014176 ATGTTTATTTTGTTGAAACAAGG + Intergenic
988594201 5:32576126-32576148 ATATTTACACTATTGAATTAAGG + Intronic
992288581 5:75261458-75261480 ATGTCTATATTGTTGAATGAAGG + Intergenic
992598505 5:78370719-78370741 ATGGTAACTCTGTTTAATCATGG + Intronic
992797850 5:80269235-80269257 ATGTTTACATTGTTCTATGAAGG + Intergenic
993281269 5:85927832-85927854 ATGTTCAAACTGGTGATTCATGG + Intergenic
993885939 5:93415039-93415061 ATGTTTAGACTGTTGGGTCAGGG - Intergenic
995764458 5:115600969-115600991 ATGTTTACACTGTTGAATCATGG - Intronic
995923486 5:117341721-117341743 ATGTATATTCTGTTGATTCAGGG + Intergenic
996085129 5:119297571-119297593 ATGTATATTCTGTTGATTCAGGG + Intronic
996455608 5:123678025-123678047 ATGTATACTCTGTTGAATTGGGG + Intergenic
997918850 5:137957763-137957785 TTGTTTAGGCTGTTGAACCAGGG + Intronic
1000952068 5:167496763-167496785 ATGTTAACACTGTAGAACCGGGG + Intronic
1001520038 5:172385001-172385023 CTGTTTCCAGAGTTGAATCAGGG + Intronic
1004203253 6:13569669-13569691 ATCTTTTCACTGCTGAATCCTGG - Intergenic
1004782249 6:18922229-18922251 ATGTTTATAATTTTGAATCTAGG + Intergenic
1004967469 6:20870681-20870703 GAGATTACACTGTTGAATCCTGG + Intronic
1005113032 6:22306693-22306715 ATGTATACATTATTGAATAAGGG + Intergenic
1005769084 6:29047100-29047122 ATGTATCCACTTTTGAATCATGG - Intergenic
1007001401 6:38317292-38317314 ATGTTTAAACTGCTGAAGGAAGG - Intronic
1007487497 6:42191738-42191760 AACTTTACAATGTTGAAACATGG + Intronic
1008164378 6:48117942-48117964 AGGTTTACAATGTTGTGTCAAGG - Intergenic
1008673634 6:53796689-53796711 ATGTTTGCTCTGTGTAATCATGG + Intronic
1010832678 6:80550470-80550492 ACGTTTTCACTTTTGAAACAGGG + Intergenic
1010843662 6:80678602-80678624 ATGTTTATTCTGTTGGTTCAGGG + Intergenic
1012061685 6:94492636-94492658 AATTTTACACTGTTGAATGCTGG + Intergenic
1012552492 6:100476860-100476882 ATGTTTGCAGTATTGAATAAGGG + Intergenic
1014021823 6:116599708-116599730 ATATTTAAACTGTTGTATCTTGG + Intergenic
1014371684 6:120617019-120617041 CTGTCTACACTGTTGCATGAAGG - Intergenic
1014658461 6:124135780-124135802 TTGATTTCACTGTTGACTCAAGG - Intronic
1014958688 6:127654665-127654687 ACGTTAACAGTGTTGAAGCAGGG - Intergenic
1015631919 6:135239734-135239756 ATGTATCCTCTGTTGATTCAAGG + Intergenic
1015926439 6:138314353-138314375 CTGTTAACACTGTTGCATTATGG + Intronic
1016165734 6:140939868-140939890 ATGTTTATTTTGCTGAATCACGG + Intergenic
1016889253 6:148989237-148989259 ATTTTTAAACTTTTTAATCAAGG - Intronic
1017282919 6:152642656-152642678 AACTTTACACTTTTGGATCAAGG - Intergenic
1022357156 7:29626862-29626884 ATGTTTACATCAATGAATCAAGG + Intergenic
1022619349 7:31966635-31966657 ATGTATACTCTGTTGATTTAGGG - Intronic
1023859732 7:44211216-44211238 TTTCTTAGACTGTTGAATCATGG + Intronic
1027284205 7:76631765-76631787 ATGTTTACAAAGTTGAGACATGG + Intergenic
1028509976 7:91613582-91613604 ATTTTTACAATCTTGAAGCAAGG - Intergenic
1030566065 7:111157911-111157933 ATGTGTTCACTGTTTAATTATGG - Intronic
1032242170 7:130171470-130171492 ATGTTTACACTGTAAGAACAAGG + Intronic
1032748640 7:134813855-134813877 GTGTTTAGAGTGATGAATCAGGG + Intronic
1033379481 7:140800256-140800278 ATGTTTAAATTGTTAAATTAAGG - Intronic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1042638358 8:70904084-70904106 ATGTATACTCTGTTGATTTAGGG + Intergenic
1043467109 8:80520726-80520748 TTTTTGAGACTGTTGAATCATGG - Exonic
1044263335 8:90154151-90154173 ATGTTTAAAATGTTTAAGCAAGG - Intergenic
1044291505 8:90476108-90476130 ATGTATACATTTTTTAATCAAGG - Intergenic
1045170015 8:99655197-99655219 ATGTATTCAGTGTTGTATCAAGG - Intronic
1045390853 8:101712955-101712977 ATGTATACACTGTTGATTTGGGG - Intronic
1047060930 8:121224574-121224596 ATGTTCAGACTCTTGAACCATGG - Intergenic
1047362901 8:124185190-124185212 ATGTTTGGACTGTGGAATCCTGG - Intergenic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1052237594 9:26230782-26230804 ATCTTTAGAATGTTGAATCTGGG - Intergenic
1053217135 9:36281273-36281295 ATATTTACAATGTGAAATCATGG + Intronic
1054824159 9:69554646-69554668 ATGTTTTGACTGGTGTATCATGG - Intronic
1055486117 9:76758453-76758475 ATAATTGCTCTGTTGAATCAGGG + Intronic
1055832965 9:80404747-80404769 ATGTTTTCAGTGATGATTCAAGG + Intergenic
1056019195 9:82423855-82423877 GTTTGTACACAGTTGAATCAGGG + Intergenic
1056172779 9:84004181-84004203 ATATTTTCATTGTTGTATCAGGG + Intergenic
1056975163 9:91246077-91246099 ATATTTACAAAGCTGAATCATGG + Intronic
1057376982 9:94533861-94533883 ATGTCTATATTGTTGAATAAAGG + Intergenic
1058341391 9:103901890-103901912 ATGATGACACTGTTGAGTGAGGG - Intergenic
1059016906 9:110528472-110528494 ATGTTTTGACTTTTTAATCATGG + Intronic
1059220260 9:112609101-112609123 CTGTTTCCATTGTTGCATCAGGG - Intronic
1186833997 X:13419528-13419550 ATGTATGCACTGTGGGATCATGG + Intergenic
1187597314 X:20787232-20787254 ATGTTAAAACCGTTGAATTATGG - Intergenic
1188257879 X:27984292-27984314 ATGTTTAAAATGTTAAATTAAGG + Intergenic
1190056472 X:47184108-47184130 CTGTCAACACTGTTGCATCAGGG + Intronic
1195260608 X:103127936-103127958 TTGTTTCCAGTGTTGAGTCACGG + Intergenic
1195599607 X:106730673-106730695 ATGCCTACAATGTTGACTCAAGG - Intronic
1196027586 X:111057286-111057308 ATTTTTTGACTTTTGAATCATGG - Intronic
1196940415 X:120770176-120770198 ATGTTTACACTATTGCCACATGG - Intergenic
1197238959 X:124102749-124102771 ATGTTTACATTGTTTATACAGGG + Intronic
1197274853 X:124466412-124466434 ATGTTTGAGCTGTTGAATTAAGG - Intronic
1197289103 X:124632902-124632924 ATTTTTACACAATTGAATTATGG + Intronic
1198717651 X:139577255-139577277 GTGTTTTCACTTTTGAATCTTGG + Intergenic
1199059810 X:143341536-143341558 ATGTTTAAGCTGCTGCATCAAGG - Intergenic
1199530921 X:148846778-148846800 ATGTTTACACAGTAATATCATGG + Intronic
1202119215 Y:21507366-21507388 ATGTTTGCACTGTAGAGACATGG - Intergenic
1202121667 Y:21530906-21530928 ATGTTTGCACTGTAGAGACATGG - Intronic
1202157338 Y:21898476-21898498 ATGTTTGCACTGTAGAGACATGG + Intronic
1202159785 Y:21922017-21922039 ATGTTTGCACTGTAGAGACATGG + Intergenic