ID: 995764749

View in Genome Browser
Species Human (GRCh38)
Location 5:115602691-115602713
Sequence CTGTACCTCTGAAAGATCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995764749_995764754 28 Left 995764749 5:115602691-115602713 CCGTAGATCTTTCAGAGGTACAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 995764754 5:115602742-115602764 CGACTTTTCCTTTCCCTTTGCGG 0: 1
1: 0
2: 0
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995764749 Original CRISPR CTGTACCTCTGAAAGATCTA CGG (reversed) Intronic
903987663 1:27240582-27240604 GTGTAACTCTGAGAGTTCTAGGG + Intronic
905530516 1:38675113-38675135 CTGGAACTCTGAAAGATAAAAGG - Intergenic
906727878 1:48057164-48057186 CTGTATTTCAGAAAGATCTTTGG + Intergenic
907834755 1:58098326-58098348 CCCTACCTCTGAAAGAGCAAGGG + Intronic
907943949 1:59115791-59115813 GTGTGCCTCTGAAAGGTCTCTGG + Intergenic
909272275 1:73638527-73638549 CTGTTTCTCTGAAAGGTCTAGGG + Intergenic
915641628 1:157231894-157231916 CTGTTCCTCAGAAAATTCTAAGG - Intergenic
917505944 1:175627002-175627024 AGGTTCCTCTGAAGGATCTAGGG - Intronic
919197576 1:194308693-194308715 CTCAACCTCTGAAAGTGCTAGGG - Intergenic
922016078 1:221648701-221648723 CTTTACCTGTGAAAAAGCTAAGG + Intergenic
922119658 1:222652032-222652054 CTTTACCTCTGAAAATTCTGAGG - Exonic
922479837 1:225932064-225932086 CTGTGGCTCTAAAAGATCTGTGG - Intergenic
1063853109 10:10215641-10215663 CTGTTCCTCTGAATTTTCTATGG + Intergenic
1064209647 10:13351467-13351489 CGCTCCCTCTGAAAGCTCTAGGG - Intergenic
1068560121 10:58504894-58504916 CTGGACAACTGAAAGAGCTATGG + Intergenic
1068636417 10:59352994-59353016 AAGTACCTCTGAAAGTTGTAGGG - Intronic
1070395956 10:76011421-76011443 CCGTACCTCTGGATGCTCTACGG + Intronic
1071090151 10:81909066-81909088 CTCTCCCTCTGAAGGCTCTAGGG + Intronic
1071772331 10:88743526-88743548 CTGAACCTCTGAAAAAAATAGGG - Intronic
1072078841 10:92007617-92007639 GTGTACCTCTGAAAGAATCAAGG - Intronic
1073551880 10:104410667-104410689 CTGAAACTCTGAAACATCAAAGG - Intronic
1075171548 10:120120543-120120565 AAATGCCTCTGAAAGATCTAAGG + Intergenic
1075915808 10:126165887-126165909 CTGTACATCTGTAAGAACAATGG + Intronic
1077898930 11:6474400-6474422 CTGTACCTCAGCACGATCTCTGG + Exonic
1078630802 11:13002076-13002098 CTGTACCCCTGGAAAACCTACGG + Intergenic
1079519394 11:21307926-21307948 TTGCACCTCAGAAAGATTTAGGG + Intronic
1083374023 11:62205226-62205248 CTGTACCTCTGAGAGGCCTGGGG - Intergenic
1085101252 11:73802118-73802140 CTGTAACTCTGCAAAAGCTAAGG + Intronic
1089394278 11:118125356-118125378 CTGTACCGCTGATGGAGCTACGG + Intergenic
1099637251 12:85229500-85229522 CTATACCTGTGAAAGAAATATGG - Exonic
1099692917 12:85982985-85983007 CACTCCCTCTGAAAGTTCTAAGG - Intronic
1100214344 12:92432283-92432305 TTGTACCTTAGAAAGATATAAGG - Intergenic
1102835359 12:116053057-116053079 CTGTCTTTCTGAAAGATTTACGG + Intronic
1106898390 13:34329869-34329891 CTCTACCTCAGGCAGATCTATGG + Intergenic
1108319451 13:49274276-49274298 ATGATCCTCTGAAAGATATATGG - Exonic
1108856007 13:54793246-54793268 CTCTCCCTCTGGAAGCTCTAGGG + Intergenic
1110095739 13:71518007-71518029 CTCTACCTCTGTCATATCTAAGG + Intronic
1111958480 13:94783538-94783560 CTGTGCATCTGAAAGGTCTTGGG + Intergenic
1112315886 13:98361747-98361769 CTGTCCCTCTCACAGATCGAAGG + Intronic
1114713015 14:24797355-24797377 CTGTTCCTCTGGAAGCTCTAGGG + Intergenic
1114913379 14:27229616-27229638 CAGCACCTCATAAAGATCTATGG + Intergenic
1115372129 14:32628524-32628546 CTGGACCACTGAAAGGTTTAGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1117965872 14:61206272-61206294 CAGTTCCTCTGAAGGCTCTAGGG + Intronic
1119012561 14:71010205-71010227 CTGTGCCACTGTAAGATCTTCGG - Intronic
1119895561 14:78216773-78216795 CGGTCCCTCTGAAGGCTCTAGGG + Intergenic
1122485892 14:102079437-102079459 CTGTCCCTCTGAAAAAATTAAGG - Intergenic
1122500089 14:102191603-102191625 TTGTATTTCTGAAAAATCTATGG - Intronic
1132390730 15:101436482-101436504 CTGTAACTGTGAAAGAACAAGGG + Intronic
1136560948 16:31038933-31038955 CTGGACCTCTGAGAGGTATAAGG - Intronic
1138792199 16:59918877-59918899 CTGTGCTTCCGAAAGGTCTATGG - Intergenic
1143536935 17:7546902-7546924 CTCAACCTCTCAAAGCTCTAGGG + Intergenic
1144453688 17:15401908-15401930 CTGAACCTTTGAGATATCTATGG + Intergenic
1150063103 17:62085710-62085732 CTGTATCTCTCAAGGATATACGG - Intergenic
1150261930 17:63800601-63800623 CCATACCTCTGAATGATCAATGG - Exonic
1152101654 17:78305065-78305087 CTGCACCTCTGAAGGATGTCAGG + Intergenic
1155503157 18:26506744-26506766 CTGTACTGCAGAAAGTTCTATGG - Intronic
1155636780 18:27965440-27965462 CTTTAGCTCTGAACCATCTATGG + Intronic
1158146736 18:54322803-54322825 CACTGCCTCTGAAAGCTCTAGGG + Intergenic
1159518399 18:69487780-69487802 CTGAAACTCTGAAAGATGTCAGG - Intronic
1163341108 19:16707778-16707800 TGGTACCTCTGAAGGATCTAGGG + Intergenic
1164577806 19:29416302-29416324 CGCTCCCTCTGAAAGCTCTAAGG + Intergenic
1167438730 19:49495948-49495970 CTGCACCTCTGAAAGTTCGTGGG + Intergenic
1168700807 19:58438446-58438468 TTCCACATCTGAAAGATCTAAGG + Intronic
928342303 2:30455455-30455477 CACCACCTCTGGAAGATCTAGGG + Intronic
928460095 2:31464219-31464241 TTCTCTCTCTGAAAGATCTAGGG - Intergenic
929208477 2:39326175-39326197 CTGAAGCTCTGCAAGTTCTATGG + Exonic
930431917 2:51288711-51288733 CTCCAGCTCTGAAAGAGCTAGGG + Intergenic
934979652 2:98829383-98829405 CTGTTGCTCTGAGAGATCTTGGG + Intronic
935049307 2:99510833-99510855 CTCTCCCTCTGAAGGCTCTAGGG + Intergenic
938255020 2:129850931-129850953 TTGTACCTCTGACAGATCTGTGG + Intergenic
939041919 2:137200129-137200151 CTATATTTCTGAAACATCTAAGG - Intronic
940672071 2:156682816-156682838 CTGTCACTTTGTAAGATCTATGG - Intergenic
943686117 2:190819861-190819883 CTGCACCTCTGAGAGTTCTCAGG + Intergenic
945402355 2:209400075-209400097 CTGAAGATCTTAAAGATCTAGGG - Intergenic
945780933 2:214171181-214171203 CTGTACCTCAGAAAATTCTGAGG + Intronic
946687749 2:222288824-222288846 CTTTTCCTCTGAAATCTCTAAGG - Intronic
948014430 2:234676523-234676545 CTGTATGTCTGAAACACCTAGGG + Intergenic
1169187397 20:3630168-3630190 CTGTCCCTCTGAAAATTCCAAGG + Intronic
1169894661 20:10489969-10489991 TTTTACCTATGAAAGATGTATGG - Intronic
1170113064 20:12826183-12826205 CTTTACATCTGAAAGATTTCTGG - Intergenic
1173721237 20:45259875-45259897 CTGTTTCTCTGGAAGGTCTAGGG - Intergenic
1177004672 21:15656703-15656725 TTGAACCTCTGAAAGTTCTTGGG - Intergenic
1180253803 21:46607931-46607953 CTGAATCTCTGAAAGAGCTTTGG + Intergenic
1182240348 22:28911143-28911165 CTGTGCCTCTGAAGGATGTCTGG + Intronic
949369987 3:3324436-3324458 CGCTTCCTCTGAAAGCTCTAAGG - Intergenic
950729356 3:14943592-14943614 CTGTCTCTCTGAATGATCTCTGG + Intergenic
950997846 3:17523421-17523443 CTCTAACTCTGAAAGGTCAAGGG + Intronic
951792977 3:26507135-26507157 ATCTACCTGTGAAAGAGCTACGG + Intergenic
954772715 3:52987095-52987117 CTGTCCCACTGGAAGATCTTCGG + Intronic
954915673 3:54147063-54147085 CTGTTCCTCTGAAAAAGGTATGG - Intronic
959025345 3:101234372-101234394 TGTTCCCTCTGAAAGATCTAGGG - Intronic
963166035 3:142204493-142204515 TTGTACCTCAGGAAGTTCTAAGG - Intronic
964323004 3:155517449-155517471 CACTCCCTCTGAAAGCTCTAGGG + Intronic
973079729 4:45975014-45975036 ATGTTCCTCTGAAATATTTAGGG + Intergenic
973119729 4:46506858-46506880 ATGGACCTCTGAAGGATCCATGG - Intergenic
973895507 4:55408647-55408669 CTGTTCCTCTGTAAAATGTAGGG - Intronic
978093020 4:104740956-104740978 CTATGCCTATGAAATATCTATGG - Intergenic
978974363 4:114850730-114850752 CTGATCTTCTGAAAGATCTAAGG + Intronic
979542271 4:121898422-121898444 CTGCACATGTGACAGATCTAGGG + Intronic
980265546 4:130510291-130510313 GTTTACCTTTGAAAGAACTAAGG + Intergenic
981340460 4:143616044-143616066 CTGAATCTGTGAAAGATCTGAGG - Intronic
981573575 4:146178873-146178895 CTGTACCTGTGAAAGGGCTTGGG + Intronic
981703803 4:147638068-147638090 GTGTACATCTGAAACATCTCAGG - Exonic
981743657 4:148030537-148030559 CTGTTGCTCTGAAAACTCTATGG + Intronic
981769576 4:148292746-148292768 CTATACCTGTCAAAGATCTTTGG + Intronic
983282210 4:165695217-165695239 CTGTACGACTTAAACATCTAAGG - Intergenic
983723489 4:170888899-170888921 CAGTACCTCAGAAAGATGAATGG - Intergenic
994469166 5:100180479-100180501 CTGTACTTCAAAAAGATTTATGG + Intergenic
995246172 5:109937881-109937903 ATGTACATCTGAAAAATCTTGGG + Intergenic
995764749 5:115602691-115602713 CTGTACCTCTGAAAGATCTACGG - Intronic
996008786 5:118457066-118457088 CTGTCCATCTGACAGATCTACGG - Intergenic
997441575 5:133912320-133912342 CTGGACCTCCCAAAGTTCTAGGG - Intergenic
1001556338 5:172640106-172640128 CTGTACCATTGGAAGATCTTGGG + Intergenic
1002652928 5:180716299-180716321 CACTCCCTCTGAAAGCTCTAGGG + Intergenic
1002934845 6:1662595-1662617 CTGTACCACTGGAACATCCAAGG + Intronic
1003160777 6:3632403-3632425 TTATACCTCTGAAAGAAATAAGG + Intergenic
1004123322 6:12847681-12847703 CTGTGCCACTGAAACATCTTGGG - Intronic
1005799149 6:29401615-29401637 CTGTACCTTTGCAACATCTTGGG + Intronic
1006279565 6:33038838-33038860 TTGAATCTCTGAAATATCTATGG + Intergenic
1008150307 6:47942109-47942131 CTTTAACTCTGAATGATTTAGGG + Intronic
1011198010 6:84802281-84802303 GTTTACCTCAGAAAGATCTGTGG + Intergenic
1017790642 6:157795561-157795583 CTGTACATCTCAAAAACCTAAGG - Intronic
1017927552 6:158923332-158923354 TTATGCCTCTGAAACATCTAAGG - Intergenic
1018172293 6:161152460-161152482 CTGTACCTCTGAAAGTCCCCAGG - Intronic
1020418724 7:7975204-7975226 CAGTAATTCTGAAAAATCTAAGG + Intronic
1020577431 7:9950648-9950670 TTGTAGCTCAGAAAAATCTAAGG + Intergenic
1021384755 7:20015523-20015545 TTGTACCTCAGAAAAATCTTTGG + Intergenic
1022515141 7:30970482-30970504 CTTTACCTCTCAGAGATCAAGGG - Intronic
1024708127 7:51984239-51984261 CTTTTACTCTGAAAGATGTAAGG + Intergenic
1025238659 7:57253075-57253097 CTGTACCTAGGGAAGATCAAAGG + Intergenic
1027757342 7:82230961-82230983 CTGTACCTCTGATACATGAAGGG + Intronic
1028668602 7:93375194-93375216 CTATACTACTGAAAGAACTATGG - Intergenic
1030174779 7:106640918-106640940 CTGTACATTTGACAGCTCTAGGG + Intergenic
1033022383 7:137739441-137739463 CCGTAACTCTGAAAGAGCCAGGG - Intronic
1036055677 8:5251304-5251326 CTGTGCATCAGAAATATCTAGGG + Intergenic
1036442238 8:8791758-8791780 CAGTACCCCTGAAATATCTAGGG + Intronic
1039742271 8:40393747-40393769 CTGTTTCCCTGAAAGATCAAGGG - Intergenic
1039854483 8:41400424-41400446 CACTCCCTCTGAAAGCTCTAGGG - Intergenic
1042316238 8:67429136-67429158 CAGTACCTGTGTAAGATCTGTGG - Intronic
1043317905 8:78944076-78944098 CTGTAACTCCCAAAGACCTACGG - Intergenic
1046289927 8:112145476-112145498 TTCTCCCTCTGAAGGATCTAGGG - Intergenic
1047164938 8:122427338-122427360 CTGGACTTCCTAAAGATCTAAGG - Intergenic
1052047799 9:23814538-23814560 CTGTGCCTCTGAATGACCCATGG - Intronic
1052273241 9:26649780-26649802 GTCTACCTTTGATAGATCTAGGG - Intergenic
1056633904 9:88316048-88316070 CACTTCCTCTGAAAGCTCTAGGG - Intergenic
1057029256 9:91761480-91761502 CTGTGCATCTGAGGGATCTAGGG - Intronic
1059757534 9:117307805-117307827 CTGAGCCTCTGAAATATCTCTGG + Intronic
1060139294 9:121193165-121193187 CTGTACCACAGAAATATCCATGG + Intronic
1187026330 X:15439003-15439025 CTGTACCTCAGAACTTTCTAAGG - Intronic
1187321763 X:18245669-18245691 CTGTACCTTTGAAGGATTAAGGG - Intronic
1189235039 X:39480303-39480325 CTGAAGCACTGAAAGAGCTATGG + Intergenic
1189941488 X:46127468-46127490 ATGTACATCTGAATGATTTATGG - Intergenic
1190468511 X:50751472-50751494 CTGTACGTCAGGAAGATCTGGGG + Intronic
1192452122 X:71251245-71251267 CTGTACCTCGGAAAGATGGGAGG + Intronic
1197014793 X:121610630-121610652 GTGTAACTCTGAAAAATGTATGG + Intergenic