ID: 995767724

View in Genome Browser
Species Human (GRCh38)
Location 5:115637049-115637071
Sequence GCCTGAGTCAGCTCAATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995767723_995767724 6 Left 995767723 5:115637020-115637042 CCAGCACACTTTTACAATCACAG No data
Right 995767724 5:115637049-115637071 GCCTGAGTCAGCTCAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995767724 Original CRISPR GCCTGAGTCAGCTCAATGAA TGG Intergenic
No off target data available for this crispr