ID: 995775625

View in Genome Browser
Species Human (GRCh38)
Location 5:115722303-115722325
Sequence GTTACATTTGAAAACATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995775625_995775628 -7 Left 995775625 5:115722303-115722325 CCTTTAATGTTTTCAAATGTAAC No data
Right 995775628 5:115722319-115722341 ATGTAACCGCACGGCAGATAGGG No data
995775625_995775635 21 Left 995775625 5:115722303-115722325 CCTTTAATGTTTTCAAATGTAAC No data
Right 995775635 5:115722347-115722369 ACAGCCATGGTTATTCGGTGGGG No data
995775625_995775631 16 Left 995775625 5:115722303-115722325 CCTTTAATGTTTTCAAATGTAAC No data
Right 995775631 5:115722342-115722364 AGTCCACAGCCATGGTTATTCGG No data
995775625_995775634 20 Left 995775625 5:115722303-115722325 CCTTTAATGTTTTCAAATGTAAC No data
Right 995775634 5:115722346-115722368 CACAGCCATGGTTATTCGGTGGG No data
995775625_995775633 19 Left 995775625 5:115722303-115722325 CCTTTAATGTTTTCAAATGTAAC No data
Right 995775633 5:115722345-115722367 CCACAGCCATGGTTATTCGGTGG No data
995775625_995775630 8 Left 995775625 5:115722303-115722325 CCTTTAATGTTTTCAAATGTAAC No data
Right 995775630 5:115722334-115722356 AGATAGGGAGTCCACAGCCATGG No data
995775625_995775627 -8 Left 995775625 5:115722303-115722325 CCTTTAATGTTTTCAAATGTAAC No data
Right 995775627 5:115722318-115722340 AATGTAACCGCACGGCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995775625 Original CRISPR GTTACATTTGAAAACATTAA AGG (reversed) Intergenic