ID: 995781214

View in Genome Browser
Species Human (GRCh38)
Location 5:115777282-115777304
Sequence GAGGAACTTGGTGTTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995781214_995781219 19 Left 995781214 5:115777282-115777304 CCCCTCTGAACACCAAGTTCCTC No data
Right 995781219 5:115777324-115777346 ATAATAGTCTCTACCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995781214 Original CRISPR GAGGAACTTGGTGTTCAGAG GGG (reversed) Intergenic
No off target data available for this crispr