ID: 995783411

View in Genome Browser
Species Human (GRCh38)
Location 5:115802247-115802269
Sequence TCTTACCTGCAGCTGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995783411_995783414 -1 Left 995783411 5:115802247-115802269 CCAAGCTCCAGCTGCAGGTAAGA No data
Right 995783414 5:115802269-115802291 ATTGGAGAAACTGAGTAGTATGG No data
995783411_995783415 0 Left 995783411 5:115802247-115802269 CCAAGCTCCAGCTGCAGGTAAGA No data
Right 995783415 5:115802270-115802292 TTGGAGAAACTGAGTAGTATGGG No data
995783411_995783416 1 Left 995783411 5:115802247-115802269 CCAAGCTCCAGCTGCAGGTAAGA No data
Right 995783416 5:115802271-115802293 TGGAGAAACTGAGTAGTATGGGG No data
995783411_995783418 30 Left 995783411 5:115802247-115802269 CCAAGCTCCAGCTGCAGGTAAGA No data
Right 995783418 5:115802300-115802322 GCCACCTGTCTCCTCACTTTAGG No data
995783411_995783417 8 Left 995783411 5:115802247-115802269 CCAAGCTCCAGCTGCAGGTAAGA No data
Right 995783417 5:115802278-115802300 ACTGAGTAGTATGGGGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995783411 Original CRISPR TCTTACCTGCAGCTGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr