ID: 995783485

View in Genome Browser
Species Human (GRCh38)
Location 5:115802923-115802945
Sequence CTATATACACATATTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995783485_995783489 6 Left 995783485 5:115802923-115802945 CCATGCTGAATATGTGTATATAG No data
Right 995783489 5:115802952-115802974 GAATTGTGTTCTAGGATGGATGG No data
995783485_995783488 2 Left 995783485 5:115802923-115802945 CCATGCTGAATATGTGTATATAG No data
Right 995783488 5:115802948-115802970 AGAGGAATTGTGTTCTAGGATGG No data
995783485_995783487 -2 Left 995783485 5:115802923-115802945 CCATGCTGAATATGTGTATATAG No data
Right 995783487 5:115802944-115802966 AGAAAGAGGAATTGTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995783485 Original CRISPR CTATATACACATATTCAGCA TGG (reversed) Intergenic
No off target data available for this crispr