ID: 995783489

View in Genome Browser
Species Human (GRCh38)
Location 5:115802952-115802974
Sequence GAATTGTGTTCTAGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995783484_995783489 26 Left 995783484 5:115802903-115802925 CCTTTTGGCGAGTTTCTTAACCA No data
Right 995783489 5:115802952-115802974 GAATTGTGTTCTAGGATGGATGG No data
995783485_995783489 6 Left 995783485 5:115802923-115802945 CCATGCTGAATATGTGTATATAG No data
Right 995783489 5:115802952-115802974 GAATTGTGTTCTAGGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995783489 Original CRISPR GAATTGTGTTCTAGGATGGA TGG Intergenic
No off target data available for this crispr