ID: 995783489 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:115802952-115802974 |
Sequence | GAATTGTGTTCTAGGATGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
995783484_995783489 | 26 | Left | 995783484 | 5:115802903-115802925 | CCTTTTGGCGAGTTTCTTAACCA | No data | ||
Right | 995783489 | 5:115802952-115802974 | GAATTGTGTTCTAGGATGGATGG | No data | ||||
995783485_995783489 | 6 | Left | 995783485 | 5:115802923-115802945 | CCATGCTGAATATGTGTATATAG | No data | ||
Right | 995783489 | 5:115802952-115802974 | GAATTGTGTTCTAGGATGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
995783489 | Original CRISPR | GAATTGTGTTCTAGGATGGA TGG | Intergenic | ||
No off target data available for this crispr |