ID: 995794624

View in Genome Browser
Species Human (GRCh38)
Location 5:115928630-115928652
Sequence GAGGTTGAAAGATCCTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995794624_995794634 21 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794634 5:115928674-115928696 ATAATTCATCGTTGTTGGGGGGG No data
995794624_995794632 19 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794632 5:115928672-115928694 GGATAATTCATCGTTGTTGGGGG No data
995794624_995794631 18 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794631 5:115928671-115928693 TGGATAATTCATCGTTGTTGGGG No data
995794624_995794629 16 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794629 5:115928669-115928691 GCTGGATAATTCATCGTTGTTGG No data
995794624_995794633 20 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794633 5:115928673-115928695 GATAATTCATCGTTGTTGGGGGG No data
995794624_995794628 -2 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794628 5:115928651-115928673 TCTGCACTTACATTTTGGGCTGG No data
995794624_995794626 -6 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794626 5:115928647-115928669 AACCTCTGCACTTACATTTTGGG No data
995794624_995794625 -7 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794625 5:115928646-115928668 CAACCTCTGCACTTACATTTTGG No data
995794624_995794630 17 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794630 5:115928670-115928692 CTGGATAATTCATCGTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995794624 Original CRISPR GAGGTTGAAAGATCCTGCTC TGG (reversed) Intergenic