ID: 995794627

View in Genome Browser
Species Human (GRCh38)
Location 5:115928649-115928671
Sequence AGCCCAAAATGTAAGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995794627_995794630 -2 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794630 5:115928670-115928692 CTGGATAATTCATCGTTGTTGGG No data
995794627_995794633 1 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794633 5:115928673-115928695 GATAATTCATCGTTGTTGGGGGG No data
995794627_995794632 0 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794632 5:115928672-115928694 GGATAATTCATCGTTGTTGGGGG No data
995794627_995794634 2 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794634 5:115928674-115928696 ATAATTCATCGTTGTTGGGGGGG No data
995794627_995794635 20 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794635 5:115928692-115928714 GGGGGTGTCCTGTGCATTGCAGG No data
995794627_995794631 -1 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794631 5:115928671-115928693 TGGATAATTCATCGTTGTTGGGG No data
995794627_995794629 -3 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794629 5:115928669-115928691 GCTGGATAATTCATCGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995794627 Original CRISPR AGCCCAAAATGTAAGTGCAG AGG (reversed) Intergenic