ID: 995794633

View in Genome Browser
Species Human (GRCh38)
Location 5:115928673-115928695
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995794623_995794633 24 Left 995794623 5:115928626-115928648 CCAGCCAGAGCAGGATCTTTCAA No data
Right 995794633 5:115928673-115928695 GATAATTCATCGTTGTTGGGGGG No data
995794624_995794633 20 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794633 5:115928673-115928695 GATAATTCATCGTTGTTGGGGGG No data
995794627_995794633 1 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794633 5:115928673-115928695 GATAATTCATCGTTGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type