ID: 995794634

View in Genome Browser
Species Human (GRCh38)
Location 5:115928674-115928696
Sequence ATAATTCATCGTTGTTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995794627_995794634 2 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794634 5:115928674-115928696 ATAATTCATCGTTGTTGGGGGGG No data
995794623_995794634 25 Left 995794623 5:115928626-115928648 CCAGCCAGAGCAGGATCTTTCAA No data
Right 995794634 5:115928674-115928696 ATAATTCATCGTTGTTGGGGGGG No data
995794624_995794634 21 Left 995794624 5:115928630-115928652 CCAGAGCAGGATCTTTCAACCTC No data
Right 995794634 5:115928674-115928696 ATAATTCATCGTTGTTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995794634 Original CRISPR ATAATTCATCGTTGTTGGGG GGG Intergenic
No off target data available for this crispr