ID: 995794635

View in Genome Browser
Species Human (GRCh38)
Location 5:115928692-115928714
Sequence GGGGGTGTCCTGTGCATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995794627_995794635 20 Left 995794627 5:115928649-115928671 CCTCTGCACTTACATTTTGGGCT No data
Right 995794635 5:115928692-115928714 GGGGGTGTCCTGTGCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995794635 Original CRISPR GGGGGTGTCCTGTGCATTGC AGG Intergenic
No off target data available for this crispr