ID: 995797125

View in Genome Browser
Species Human (GRCh38)
Location 5:115953378-115953400
Sequence CACTGGCCAATGATGTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995797125_995797128 13 Left 995797125 5:115953378-115953400 CCAAGCTACATCATTGGCCAGTG No data
Right 995797128 5:115953414-115953436 TTCACCAGCATCTCTCTGCTGGG No data
995797125_995797127 12 Left 995797125 5:115953378-115953400 CCAAGCTACATCATTGGCCAGTG No data
Right 995797127 5:115953413-115953435 TTTCACCAGCATCTCTCTGCTGG No data
995797125_995797129 16 Left 995797125 5:115953378-115953400 CCAAGCTACATCATTGGCCAGTG No data
Right 995797129 5:115953417-115953439 ACCAGCATCTCTCTGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995797125 Original CRISPR CACTGGCCAATGATGTAGCT TGG (reversed) Intergenic
No off target data available for this crispr