ID: 995797892

View in Genome Browser
Species Human (GRCh38)
Location 5:115961596-115961618
Sequence TGGGCTGGAACTGGTTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995797892_995797901 1 Left 995797892 5:115961596-115961618 CCGGGAAAACCAGTTCCAGCCCA No data
Right 995797901 5:115961620-115961642 GAATTTCTGGGTGGAAACACTGG No data
995797892_995797898 -8 Left 995797892 5:115961596-115961618 CCGGGAAAACCAGTTCCAGCCCA No data
Right 995797898 5:115961611-115961633 CCAGCCCAGGAATTTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995797892 Original CRISPR TGGGCTGGAACTGGTTTTCC CGG (reversed) Intergenic
No off target data available for this crispr