ID: 995801511

View in Genome Browser
Species Human (GRCh38)
Location 5:116001292-116001314
Sequence CCCACAGGCTGGATTCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995801511_995801517 1 Left 995801511 5:116001292-116001314 CCCAATGGAATCCAGCCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 355
Right 995801517 5:116001316-116001338 GAAGAAGCGTTACCCCCGCTGGG 0: 1
1: 0
2: 1
3: 3
4: 19
995801511_995801516 0 Left 995801511 5:116001292-116001314 CCCAATGGAATCCAGCCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 355
Right 995801516 5:116001315-116001337 TGAAGAAGCGTTACCCCCGCTGG 0: 1
1: 0
2: 1
3: 1
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995801511 Original CRISPR CCCACAGGCTGGATTCCATT GGG (reversed) Intronic