ID: 995801511 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:116001292-116001314 |
| Sequence | CCCACAGGCTGGATTCCATT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 376 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 19, 4: 355} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995801511_995801517 | 1 | Left | 995801511 | 5:116001292-116001314 | CCCAATGGAATCCAGCCTGTGGG | 0: 1 1: 0 2: 1 3: 19 4: 355 |
||
| Right | 995801517 | 5:116001316-116001338 | GAAGAAGCGTTACCCCCGCTGGG | 0: 1 1: 0 2: 1 3: 3 4: 19 |
||||
| 995801511_995801516 | 0 | Left | 995801511 | 5:116001292-116001314 | CCCAATGGAATCCAGCCTGTGGG | 0: 1 1: 0 2: 1 3: 19 4: 355 |
||
| Right | 995801516 | 5:116001315-116001337 | TGAAGAAGCGTTACCCCCGCTGG | 0: 1 1: 0 2: 1 3: 1 4: 11 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995801511 | Original CRISPR | CCCACAGGCTGGATTCCATT GGG (reversed) | Intronic | ||