ID: 995803111

View in Genome Browser
Species Human (GRCh38)
Location 5:116021181-116021203
Sequence TACAATTTATAAATTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995803109_995803111 16 Left 995803109 5:116021142-116021164 CCAGAACAATGCTTCTAAGTATC 0: 1
1: 0
2: 1
3: 10
4: 118
Right 995803111 5:116021181-116021203 TACAATTTATAAATTGCCCAAGG 0: 1
1: 0
2: 3
3: 16
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995803111 Original CRISPR TACAATTTATAAATTGCCCA AGG Intronic
901618926 1:10565710-10565732 TACAATTTTTAAATTGAGTAAGG - Intronic
907630587 1:56077347-56077369 TACAATTTATAATGTGCCAGAGG - Intergenic
908973816 1:69871511-69871533 TATATTTTATAAATTACACATGG - Intronic
910154679 1:84201359-84201381 TACAATAGATAAATGGGCCAAGG - Intronic
911112252 1:94202037-94202059 TACTAATTATAAATTGTACATGG - Intronic
911258670 1:95661855-95661877 TACAATTTAAAAATGGGCAAAGG - Intergenic
911720688 1:101188103-101188125 TACAATTTTTAAATTTCTAATGG + Intergenic
912760646 1:112363610-112363632 TACAAGTTTTAAATAGCCAATGG - Intergenic
914959348 1:152192509-152192531 CACAGTTTACAATTTGCCCATGG - Intergenic
915017496 1:152748151-152748173 TACAATTTAAAAATGGGCAATGG - Intronic
916354492 1:163889532-163889554 TACAATGAATAAATTCCACATGG - Intergenic
917677362 1:177332631-177332653 TCCAATTGATAAAGAGCCCAAGG - Intergenic
918155245 1:181838856-181838878 TAAAATTTATAGATTTCCAAAGG + Intergenic
918652609 1:186984224-186984246 TACTATATACAAATTCCCCATGG - Intronic
918833106 1:189424064-189424086 TACAATAAATATGTTGCCCATGG - Intergenic
919273237 1:195378058-195378080 AACAATTTTTAAATTTCCTAAGG + Intergenic
919699147 1:200613244-200613266 AACAATTTATAGATTCCCAAAGG + Intronic
923584595 1:235256427-235256449 GACAATTTAAAAATTGCTCTGGG + Intronic
924370001 1:243337691-243337713 TAAAATTTATTAAATGCCCACGG - Intronic
1064888589 10:20141126-20141148 TACAATTTATCAAATGTCAAAGG - Intronic
1065741178 10:28798563-28798585 TAGAATTTCTAAATTACCCTTGG - Intergenic
1066028944 10:31397616-31397638 AACAAATTATATATAGCCCATGG + Intronic
1066207298 10:33202174-33202196 TACCATTTGGAAATTGGCCAAGG - Intronic
1066536079 10:36393685-36393707 CACAATTTAAAAATGGCCAAAGG + Intergenic
1067465307 10:46493890-46493912 TTCTCTTTATAAATTACCCAGGG - Intergenic
1067621880 10:47890711-47890733 TTCTCTTTATAAATTACCCAGGG + Intergenic
1068205446 10:53845037-53845059 TCCAATTTAAAAATGGGCCAAGG + Intronic
1068353016 10:55873937-55873959 TGGAATTTATAATTTGCCAAAGG + Intergenic
1068633058 10:59318239-59318261 AACAATTTATCAAATGACCAAGG + Intronic
1068843666 10:61645984-61646006 TACAATTAATAAGTTGCTCCAGG + Intergenic
1069252612 10:66288859-66288881 TACAATTTTGCAATAGCCCAGGG - Intronic
1070617500 10:77980080-77980102 TACTATTTACAAATAGACCATGG - Intronic
1071619074 10:87102403-87102425 AACAATTTAAAAATTACCCAGGG - Intronic
1072018805 10:91378680-91378702 TAAAATGTATAGATTGGCCATGG - Intergenic
1072061995 10:91822224-91822246 TTTAATTTATAAATTTCCCTAGG + Intronic
1072516287 10:96186363-96186385 TACAATTTTTAATATGCTCATGG + Intronic
1073904281 10:108259560-108259582 TACAATTTCTAAACTGTCTAGGG + Intergenic
1073993596 10:109291709-109291731 TAGAATTAATCAATTACCCATGG - Intergenic
1074449554 10:113548087-113548109 TAGATATAATAAATTGCCCAAGG - Intergenic
1074698491 10:116072415-116072437 TACAATTTAGAACTTGCTCCTGG + Intronic
1075123738 10:119683079-119683101 TACAAGTTTTAAATAGCCAATGG + Intergenic
1078943054 11:16031013-16031035 TACAATTTATAAGATGCTAATGG - Intronic
1081286941 11:41282178-41282200 TACAATTTACAAAATTGCCAGGG - Intronic
1085752515 11:79174084-79174106 TGCTATTTATGAATTCCCCAGGG - Intronic
1085973095 11:81617604-81617626 TACAATTTAAAAATGGGCAAAGG + Intergenic
1086363997 11:86089431-86089453 TACATCTTAAAAATTGCCCCAGG - Intergenic
1087467655 11:98529624-98529646 GACAATTTATCAATTCCACAGGG - Intergenic
1087827573 11:102783577-102783599 CACAATGGATAAATTGCCTAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089199726 11:116716807-116716829 TAGAATGTATATATGGCCCAAGG - Intergenic
1091100171 11:132864586-132864608 TACAATTTATAGATGACCAATGG - Intronic
1091161363 11:133424022-133424044 TGTTATTTATAAATTACCCAGGG + Intronic
1092306713 12:7308951-7308973 TATAAATAATAACTTGCCCAAGG - Intronic
1093459314 12:19394083-19394105 TAAAATTTAAAAATAGGCCAGGG + Intergenic
1094124585 12:27010192-27010214 AACAACTTTTAAACTGCCCAAGG + Intronic
1095416609 12:41983918-41983940 AACATTTTATAAATTTGCCAAGG + Intergenic
1095760532 12:45829594-45829616 TACAATCTATAAATGGAACATGG - Intronic
1095760535 12:45829701-45829723 TACAATCTATAAATGGAACATGG - Intronic
1096169449 12:49455565-49455587 TAAAATTTAAAAATTAGCCAGGG - Intronic
1096931396 12:55213805-55213827 TACAATCTATAAATTACCTTGGG - Intergenic
1097607908 12:61778547-61778569 TACTATTTATTAGATGCCCATGG + Intronic
1097970748 12:65630454-65630476 GAAAATTTATGATTTGCCCAAGG + Intergenic
1099487519 12:83246748-83246770 TAAAATCTGTAAATTGCCCTGGG + Intergenic
1099924491 12:89000895-89000917 TCCAATTTTTAAACTACCCAGGG + Intergenic
1102658754 12:114506283-114506305 TACCAGTTATAAAGTGCCCCTGG + Intergenic
1103740477 12:123087776-123087798 AAAAATTTTAAAATTGCCCAGGG - Intronic
1106717570 13:32407021-32407043 TACAATTTAAAAATAGTCCTTGG - Intronic
1107365079 13:39663453-39663475 TATATTTTAAAAATTGCACAAGG + Intronic
1109294277 13:60511831-60511853 AACAATATGTAAATTGCCTATGG - Intronic
1111855701 13:93634371-93634393 TAAAATTTAGAAATGGCCAAGGG + Intronic
1112445329 13:99459099-99459121 TACAATTTATCAGTCGCCAAAGG - Intergenic
1112707246 13:102084627-102084649 TACAAATTATACATTGTCAAAGG + Intronic
1112990380 13:105506299-105506321 TAACATTTTTAAATTGCCCCTGG - Intergenic
1114717248 14:24840129-24840151 GACAGGTTATAAATTGCCCAAGG + Intronic
1115181694 14:30634430-30634452 TATAATTTATAAATTGGGCACGG - Intronic
1115487413 14:33925313-33925335 AACAATTTATAAGTGTCCCATGG - Exonic
1115639917 14:35328573-35328595 AACAATTTAAAAATTGGCAAAGG + Intergenic
1116969148 14:51046745-51046767 TAGAGTTTTTAATTTGCCCAGGG - Intronic
1117541787 14:56754221-56754243 TACAATTTGTGAACTGCCCATGG - Intergenic
1118156220 14:63244773-63244795 TACATTAAATAATTTGCCCAAGG + Intronic
1118828835 14:69409639-69409661 GACATTTTTTAAAATGCCCAAGG - Intronic
1119641831 14:76321183-76321205 TACATTTTATAAAATGGCAAAGG - Intronic
1119961689 14:78865228-78865250 TACAATTGATCTATTGGCCATGG + Intronic
1122647618 14:103205928-103205950 TACATTTTATAAAGTGCCCCGGG + Intergenic
1124550568 15:30677293-30677315 TTGAATTTATAAATTGCTCTGGG - Intronic
1126857197 15:52850152-52850174 TTCAATTTATTAATTGCTTATGG + Intergenic
1126931070 15:53651952-53651974 AACAATTTATAAATTAACTATGG - Intronic
1126974534 15:54159955-54159977 TACAATTGATGTTTTGCCCAAGG - Intronic
1129061090 15:72860955-72860977 TACCTTTTATAAATGCCCCAGGG + Intergenic
1129785294 15:78306218-78306240 TACAATTCATAAAGAGGCCAAGG + Intergenic
1131321871 15:91401524-91401546 AGCAATTAATAAGTTGCCCAAGG + Intergenic
1131458476 15:92601790-92601812 TGCAATTTATCACTTCCCCAGGG - Intergenic
1131912041 15:97217061-97217083 TTCTATTTCTAAATTGCCCATGG + Intergenic
1133493839 16:6297467-6297489 GGCATTTTATAAAATGCCCAAGG - Intronic
1137580289 16:49629607-49629629 AACAATGTATTAATTACCCAGGG - Intronic
1137663749 16:50235193-50235215 TGCAATTTATAAAATTTCCAAGG - Intronic
1138822807 16:60281809-60281831 TACACTTTAAAAATAGCCCTTGG - Intergenic
1139155569 16:64437694-64437716 CTCAATTTAAAAATTGGCCAAGG + Intergenic
1139281773 16:65776906-65776928 TACAATTAATAAATTAATCAGGG + Intergenic
1140179649 16:72702135-72702157 TTCCTTTTATCAATTGCCCATGG - Intergenic
1142687378 17:1585538-1585560 AAAAATTTAAAAATTGGCCAGGG - Intronic
1143114225 17:4572548-4572570 TACAAGTTTTAAATAGCCAATGG - Intergenic
1144333428 17:14246996-14247018 TCCAAATTATAAAATGCACAAGG - Intergenic
1144364568 17:14529960-14529982 TACAATATATACAGTGCACAGGG - Intergenic
1148261794 17:46190851-46190873 TACATTTTTTAAATTCCCAAGGG + Intronic
1149318904 17:55464922-55464944 TCCATTTTATCAATTGCCTATGG - Intergenic
1150459820 17:65340414-65340436 TTGAATTTATAAATTGCTCTGGG - Intergenic
1152084383 17:78208818-78208840 TTTAATTTATAAATTGGCAAAGG + Intergenic
1153036727 18:770632-770654 TACAATTTAGAATGTGCCCCAGG + Intronic
1154090618 18:11357572-11357594 CTCAATTTATAAATTGGCAATGG + Intergenic
1155316451 18:24576312-24576334 TAGTATTTATAAATTACACATGG - Intergenic
1155661255 18:28251180-28251202 ATCAATTTATAGATTGCTCAGGG + Intergenic
1156820578 18:41367746-41367768 GACCATTTATAAATTGACAATGG - Intergenic
1157176715 18:45458706-45458728 GAGAATTTTAAAATTGCCCAAGG + Intronic
1157874849 18:51262801-51262823 TTCAATTTAGAAATTTTCCAGGG + Intergenic
1159358876 18:67374287-67374309 GACAATTTACAAAGTGCTCAAGG - Intergenic
1159779923 18:72649406-72649428 CTCAATTTATATATTGCTCAGGG - Intergenic
1159872284 18:73771865-73771887 ATTAATTTATAAATTGTCCAGGG - Intergenic
1162184206 19:8892022-8892044 AACAATTTAAAAATTGCCTCAGG + Intronic
1166215649 19:41332922-41332944 GACAATTTATAGCATGCCCATGG - Intronic
1167562991 19:50237626-50237648 TGCAATTTAAAAAATGCTCATGG - Intronic
925020864 2:566759-566781 TACAATTTATAAAAAGGACACGG + Intergenic
932817669 2:74874734-74874756 TTCTATTTGTAAATTGTCCATGG + Intronic
933134824 2:78720227-78720249 TACCACTCATAAAATGCCCAGGG + Intergenic
933860096 2:86458076-86458098 TAAAATTTAAAAACTGACCAAGG + Intronic
934900022 2:98152279-98152301 TAATATTTATAAATTGAACATGG + Intronic
936804408 2:116310441-116310463 TCCAATTTATAAATGGGCCAAGG - Intergenic
937817965 2:126274689-126274711 TACACTTTATACATGGCCCATGG - Intergenic
937943773 2:127312412-127312434 TACGATTTAAAAGTTGCTCATGG + Intronic
939469682 2:142604622-142604644 TACAATTTAGAAATTGCCTAAGG + Intergenic
940012381 2:149068543-149068565 TACAAATTTTAAATAGCCAATGG + Intronic
940719146 2:157262476-157262498 AAAAATTTAAAAATTACCCAAGG + Intronic
941153538 2:161945789-161945811 TACACTCTATAATTTGCCAATGG - Intronic
941809664 2:169743000-169743022 GAGATTATATAAATTGCCCAAGG + Intronic
941812158 2:169766018-169766040 TACAAGTTTTAAATAGCCAATGG + Intronic
942289051 2:174451478-174451500 TAAAAATTCTAATTTGCCCATGG + Intronic
942674553 2:178413499-178413521 TACATTTTAGAAATTGCCGGTGG - Intergenic
943521638 2:188958899-188958921 TCCAATTCATAAATTGTCAATGG - Intergenic
943836466 2:192520349-192520371 TACAATTTCTAAATTACCTTGGG + Intergenic
943919878 2:193692424-193692446 TACATTATATACATTTCCCAGGG + Intergenic
945013512 2:205490075-205490097 TACCATTTCAAAATTGCCAAGGG + Intronic
945442997 2:209902648-209902670 TAAAAATTATAACTTGCCAAAGG + Intronic
945458604 2:210078332-210078354 TACAATTTTTAAATTTCTAAGGG + Intronic
945518863 2:210798116-210798138 GAGAATTAATAACTTGCCCAAGG + Intergenic
945611078 2:212003855-212003877 GAAAATATATAACTTGCCCAAGG - Intronic
945941127 2:215951335-215951357 TACAATTTAAAAATTGGAGAGGG - Intronic
946665919 2:222050004-222050026 TACACTTTACAAATTACTCATGG + Intergenic
946674493 2:222144341-222144363 GATTTTTTATAAATTGCCCAAGG - Intergenic
1169660305 20:7971950-7971972 TTAACTTTATAAATTGCCCCTGG - Intergenic
1171066777 20:22025030-22025052 TACAATAAATAAATAACCCAAGG - Intergenic
1171319680 20:24231277-24231299 CACAATTTAAAAATTGGCAAAGG + Intergenic
1173299819 20:41792237-41792259 ATCAATTTACATATTGCCCATGG - Intergenic
1174520897 20:51129738-51129760 TATAATTTTTAGATTGGCCAAGG + Intergenic
1174687135 20:52466789-52466811 TAAAATTTATATATTTACCATGG + Intergenic
1175091589 20:56509157-56509179 TACAATTAAGAAATGGACCAGGG + Intronic
1176612306 21:8994277-8994299 TTCAATTTATTGATTCCCCAGGG + Intergenic
1177044210 21:16149339-16149361 TAATATTTATAAATTGCAGAGGG - Intergenic
1177674464 21:24278586-24278608 TAAAATTGATACATTGCTCATGG + Intergenic
1178501357 21:33128183-33128205 TACAAACTTTAAATTACCCAGGG - Intergenic
1181989642 22:26827655-26827677 TACTTGTTATAAATTCCCCAAGG - Intergenic
1182341637 22:29626699-29626721 CACAATTTTTACATTGTCCAGGG + Intronic
949679624 3:6497905-6497927 TTGAATCTATAAATTGCCCTGGG - Intergenic
949745014 3:7280797-7280819 TACAATTGATAACTTGCTAATGG + Intronic
950245193 3:11409205-11409227 TACAATTTTTCAATTTACCATGG + Intronic
951304411 3:21040759-21040781 TACCATTTATAAAATGACTATGG - Intergenic
951458531 3:22921839-22921861 TACATTTTGTAGTTTGCCCAGGG + Intergenic
951892126 3:27577155-27577177 TAAAATGTACATATTGCCCAAGG - Intergenic
952322414 3:32290676-32290698 TGGAATTTAAAATTTGCCCAAGG + Intronic
952447384 3:33394867-33394889 TACAATTTACATATTGTCTATGG + Intronic
953136256 3:40184791-40184813 TACAATTGAAAAATTACCTATGG - Intronic
954762354 3:52885239-52885261 TGCAATTTAAAAATTGGCAAAGG - Intronic
956546540 3:70409179-70409201 TACAATTGAGAAATTTGCCATGG + Intergenic
957741884 3:84281087-84281109 TAAAATTTGTCAATTGGCCACGG + Intergenic
959516877 3:107277756-107277778 TACAATTTTTCAAGTGCACATGG + Intergenic
959580586 3:107978792-107978814 CACATTTAATAACTTGCCCAAGG + Intergenic
960230212 3:115217172-115217194 TATAATTTATAAATAAGCCAGGG + Intergenic
960673483 3:120173684-120173706 TATAATTTTTAAAATGCCAAAGG + Intronic
961122815 3:124387472-124387494 AAAAATTAATAATTTGCCCATGG + Intronic
962122086 3:132572467-132572489 TTAAATCTATAAATTGCCCCAGG - Intronic
962540028 3:136371923-136371945 TTCAATCTATAAATTACCCTGGG + Intronic
963303568 3:143625188-143625210 TTGAATTTATAAATTGCCTTGGG - Intronic
963444926 3:145393118-145393140 TACAATTTTTATATTCCCAATGG - Intergenic
964083049 3:152783928-152783950 TACAATTTACATATTTGCCATGG + Intergenic
964316114 3:155445791-155445813 AACAGTTTATGAATTGGCCAAGG - Intronic
965328085 3:167332837-167332859 TAGTTTTTATAAATTGCCAAAGG - Intronic
965784232 3:172319253-172319275 TACAATTTACAAATGAACCAAGG - Intronic
965856567 3:173095979-173096001 AACAATTCCTAAATTGCCAAAGG + Intronic
966091910 3:176148638-176148660 TTTAATATATAAATTGCCTATGG - Intergenic
966153954 3:176896023-176896045 TGCTCTTTATAAATTGCCTATGG + Intergenic
966387980 3:179422146-179422168 CACAATTTAAAAATTGCAAATGG + Intronic
967440218 3:189499062-189499084 TACAAATTAGAATTAGCCCAGGG + Intergenic
967711138 3:192709679-192709701 TTCCAGTTATAAATTGGCCAGGG + Intronic
968722161 4:2215780-2215802 TTCCTTTTATAAATTTCCCAAGG - Intronic
968847076 4:3049853-3049875 TAAAATATGTAAATAGCCCAGGG + Intergenic
969710988 4:8843493-8843515 GTCAATTTAAAAATAGCCCAAGG + Intergenic
971005176 4:22365428-22365450 AAAAATTTAAAAATTACCCAGGG + Intronic
971601058 4:28592626-28592648 TCCTGTCTATAAATTGCCCAGGG - Intergenic
971694117 4:29875650-29875672 TTGAATTTATAAATTGCCTTCGG + Intergenic
971821099 4:31556280-31556302 TATAATTTATAATTTGCTCAAGG + Intergenic
971873827 4:32277926-32277948 TACAAATTAAAAACAGCCCATGG + Intergenic
972999438 4:44927686-44927708 TACAATTAACAAATTGCAGAAGG - Intergenic
973202273 4:47517532-47517554 TGCTTTTTGTAAATTGCCCAAGG - Intronic
973244732 4:47999204-47999226 TTCAATTTATAAATTAGGCATGG - Intronic
973921894 4:55695370-55695392 TTCAATCTATAAATTGCCTTGGG - Intergenic
973949354 4:55995549-55995571 TTCATTTTATATATTGCCTAGGG - Intronic
974442220 4:61934058-61934080 TACAATTTATATATTTCCTGTGG - Intronic
974708583 4:65557624-65557646 TACTTTTTACAAATTTCCCAGGG - Intronic
974945156 4:68517805-68517827 TACAATTTCTAAATTACCATAGG + Intergenic
976333924 4:83863840-83863862 GAGAATTTATCAATTGCCCTTGG + Intergenic
976837280 4:89389347-89389369 AAGATTTAATAAATTGCCCAAGG - Intergenic
977634670 4:99283350-99283372 TACATTTTTTTAATTGGCCAGGG + Intronic
977865940 4:102027782-102027804 TACAGTTTATAAAGAACCCATGG + Intronic
978283905 4:107051927-107051949 TACAATTTATAAATGCCATAGGG - Intronic
979643012 4:123032026-123032048 TACAATAGATTAATTGCCCTGGG + Intronic
979797515 4:124864515-124864537 TACATTTTATAACTTTCCCGTGG - Intergenic
982225064 4:153157425-153157447 TAGAATGTGTAAATGGCCCAGGG + Intronic
982402292 4:154981818-154981840 TACAATATCAAAATTGACCACGG + Intergenic
982523201 4:156445881-156445903 AACAATTTACTAATTACCCATGG + Intergenic
983648202 4:170013191-170013213 TATACTGTTTAAATTGCCCAGGG + Intronic
984333388 4:178356135-178356157 GGCAATTTAGAAATTGCCTAAGG - Intergenic
984585229 4:181556163-181556185 TAAAATGTATAAATTTCCCTTGG - Intergenic
987270744 5:16305931-16305953 TATAATTTATAAAATGCAAATGG - Intergenic
987318608 5:16747399-16747421 TACATTGTAGAAATTGCTCATGG - Intronic
987724639 5:21681782-21681804 GAAAAATTATAAATTACCCAAGG + Intergenic
988429282 5:31100624-31100646 CACAATTTTCAAATTGTCCATGG + Intergenic
990438497 5:55820267-55820289 TACAACTTATAAAATGATCAAGG - Intergenic
990454165 5:55968449-55968471 TGCAATTTATATACTACCCAAGG + Intronic
991220632 5:64211400-64211422 TAAACTTTATAAATTAGCCAAGG - Intronic
991518058 5:67461718-67461740 TAGAATTTTTATTTTGCCCAAGG + Intergenic
992214675 5:74514435-74514457 TTCAATTTATAACTGTCCCAAGG + Intergenic
993245598 5:85448507-85448529 TACAATTTGCAAATGGCCCTGGG + Intergenic
993786016 5:92137654-92137676 TACATTTTCTAAATTGCTGATGG - Intergenic
994348415 5:98716042-98716064 TTCAATCTATAAATTGCCCTGGG + Intergenic
994964320 5:106648381-106648403 TTTAAGTTATAAAGTGCCCATGG - Intergenic
995786836 5:115839956-115839978 TACAATCTAAATATTGCCCGAGG - Intronic
995803111 5:116021181-116021203 TACAATTTATAAATTGCCCAAGG + Intronic
998849167 5:146338051-146338073 GACAATTTAGAGTTTGCCCATGG - Intronic
999817405 5:155191456-155191478 AAAAATTTATAACTTGCCCAAGG + Intergenic
1000172730 5:158719146-158719168 TCCAATATATAAATTCCCAAAGG + Intronic
1001288155 5:170438488-170438510 TAAAATTTAAAAATTGCCCACGG + Intronic
1002654017 5:180728023-180728045 TCCAATTTAAAAATGGCCAAAGG + Intergenic
1003511706 6:6786709-6786731 TCCAATTTATATATTGCCTCGGG - Intergenic
1005149066 6:22727325-22727347 TACATTATATAAAATGGCCAAGG + Intergenic
1006561294 6:34914987-34915009 TACATTAAATAATTTGCCCAAGG - Intronic
1008198004 6:48549224-48549246 TACAATTTATATATTCTCCTTGG - Intergenic
1009265711 6:61552082-61552104 TTGAATTTATAAATTGCCTTTGG + Intergenic
1010092059 6:71994554-71994576 TATAGTTTTTTAATTGCCCAAGG + Intronic
1010680279 6:78791045-78791067 TTCAATTTATAAATTGCTTGGGG - Intergenic
1010762481 6:79739152-79739174 TACAATTGTTTAATTGCCAATGG - Intergenic
1011190786 6:84726081-84726103 TACAATGTATAACTCCCCCAAGG + Intronic
1011876423 6:91967073-91967095 TTCCCTTTATAAATTACCCAGGG + Intergenic
1012009495 6:93764297-93764319 TACAATTTCTAAACTGTCCATGG - Intergenic
1012198791 6:96378835-96378857 TACTATTCTTAAATGGCCCATGG + Intergenic
1013119382 6:107127740-107127762 TTCAATTCAGAAATTGCCCCTGG - Intergenic
1013436261 6:110111485-110111507 TACAAATTATAAATGGGCTAAGG + Intronic
1013897563 6:115108509-115108531 TTCAATATATAAATGGGCCAAGG + Intergenic
1014004527 6:116402760-116402782 TACATTTTAAAAAGGGCCCAGGG - Intronic
1014657481 6:124126506-124126528 TACTATTGATGAATTGTCCATGG + Intronic
1014709420 6:124788829-124788851 TAAATTTTATAAATTGCCACTGG + Intronic
1014863643 6:126502411-126502433 TATAATTTATAATCTCCCCAGGG + Intergenic
1016562162 6:145408720-145408742 TGCTGTTTATAAATTACCCAAGG - Intergenic
1016776070 6:147906025-147906047 TATAATTTATAAACTGTCCAGGG - Intergenic
1019790064 7:3005987-3006009 GACAATATATAAATTTCACAGGG + Intronic
1020862133 7:13506872-13506894 TATAACTGTTAAATTGCCCAAGG - Intergenic
1020957089 7:14753555-14753577 TGCAATTTTAAAATTTCCCATGG + Intronic
1021531005 7:21645047-21645069 TACAACTTATACATTGGCTATGG - Intronic
1023611241 7:41973143-41973165 CATAATTTAAAAATTGCCGATGG + Intronic
1024790751 7:52962716-52962738 CACAATTTATAAATTTGCAAAGG + Intergenic
1028672246 7:93415544-93415566 TAAAATTTACATATTTCCCAAGG + Intergenic
1030853643 7:114523142-114523164 TACAATTTACAAATTTTACAGGG - Intronic
1031512824 7:122670409-122670431 TAAAATTTAAAAATTAGCCAGGG + Intronic
1033975181 7:147092110-147092132 AACAATTTATGCATTTCCCAAGG - Intronic
1037040437 8:14224685-14224707 TAAAAATTATAAAATGGCCAGGG + Intronic
1038924232 8:32120001-32120023 GAGATTTAATAAATTGCCCAAGG - Intronic
1039021465 8:33211717-33211739 TCCAATTTATAAAGTGACAAGGG + Intergenic
1039783395 8:40810790-40810812 TACAATGTATAAATTCAACAAGG + Intronic
1040692793 8:49959960-49959982 TGAAATTAATAAATTACCCAAGG + Intronic
1040839933 8:51774403-51774425 TACTTTTTCTAAATTGTCCATGG + Intronic
1041655890 8:60350259-60350281 TACAAATGAGAAATTGACCATGG - Intergenic
1042283466 8:67080735-67080757 TACAAATTAGAAATAGCCAAAGG + Intronic
1043264650 8:78249236-78249258 TACTATTTGTCAATTGCCCTGGG - Intergenic
1043615652 8:82122001-82122023 TTAAATTTCTCAATTGCCCAAGG - Intergenic
1044018083 8:87071194-87071216 TTCAATATATAAATTTCTCAAGG + Intronic
1045898857 8:107250492-107250514 TAAAAATTAAAAATTGCCTAAGG + Exonic
1046218160 8:111177007-111177029 TCCAATTTAAAAATTGGCTAAGG + Intergenic
1047069381 8:121325971-121325993 CTCAATTTATAAATTCCCCCTGG - Intergenic
1047553801 8:125907202-125907224 TACACTTTATAAAGTTCTCATGG - Intergenic
1048599210 8:135901052-135901074 GGGAATTTAGAAATTGCCCAAGG + Intergenic
1049827858 8:144681613-144681635 TACTATTGATAAATTGTTCAAGG + Intergenic
1050453940 9:5814440-5814462 TACATTTTAAAAAATGACCAAGG + Intronic
1051105191 9:13571269-13571291 TGCAAGTTATAAGTTGCTCATGG + Intergenic
1052157160 9:25206294-25206316 AACAAATTATAATTTGCACAAGG - Intergenic
1052572863 9:30250835-30250857 TACAATTGTTAAGTTTCCCAAGG + Intergenic
1055115224 9:72598588-72598610 TACAATTACTAAATTCTCCAAGG + Intronic
1057600364 9:96451244-96451266 TGCAACTTATAAATAGCTCAAGG + Intronic
1058401134 9:104620755-104620777 GAGAATTTATAAATTGCCCATGG - Intergenic
1058538379 9:105987017-105987039 TACAAATTAGAAATTGTGCAAGG - Intergenic
1058989796 9:110244109-110244131 TACAAGTTTTAAATAGCCAATGG + Exonic
1059501147 9:114755394-114755416 TACATTCTATCAATTGCCAACGG + Intergenic
1186681899 X:11883592-11883614 TACACTTTGTAAATGGTCCATGG + Intergenic
1187375873 X:18754133-18754155 TAACATTTGTAAATGGCCCAAGG - Intronic
1187506738 X:19884646-19884668 TACAATAAATACATTGCCAAAGG + Intronic
1187845758 X:23535194-23535216 AACAATATAAAAATTACCCATGG - Intergenic
1188403988 X:29783631-29783653 GAGAATTTATACATTACCCAGGG - Intronic
1190095452 X:47476486-47476508 TTCAATTTAAAAATAGGCCAAGG + Intronic
1190478217 X:50849134-50849156 TAAAATTTATTAATTTCACATGG - Intergenic
1192370704 X:70510654-70510676 GACATTTAATAACTTGCCCAAGG + Intergenic
1192420424 X:71024950-71024972 TAAAATTTAAAAATTAGCCAGGG + Intergenic
1193584916 X:83309774-83309796 TATAATTTATTACTTGACCAAGG + Intergenic
1193959651 X:87909506-87909528 TCAAATTTATAAATTGCCCTGGG - Intergenic
1194206953 X:91020757-91020779 TATAATTGATAAATTGCTTAAGG - Intergenic
1194945086 X:100057475-100057497 TACATGTTATATATTGTCCAAGG + Intergenic
1195281533 X:103339389-103339411 TGCAATTTAAAAATTGGCAAAGG + Intergenic
1195784201 X:108500766-108500788 TAAAATTTATAAACTGTACAAGG - Intronic
1195859208 X:109363367-109363389 TACTATTTATTAAGTGCCCTTGG + Intergenic
1196398049 X:115287085-115287107 GACATTTAAAAAATTGCCCAAGG - Intergenic
1197002760 X:121457810-121457832 TTTAATTTATAAATTGTCTATGG - Intergenic
1198340614 X:135710005-135710027 TACAATTAATAAAGTGGTCAAGG - Intergenic
1199354486 X:146845679-146845701 TGCAATTTAAAAATTGGCAAAGG + Intergenic
1200552704 Y:4595546-4595568 TATAATTGATAAATTGCTTAAGG - Intergenic
1201505626 Y:14696286-14696308 TCCAATATATAAATTTCCCAGGG + Intronic