ID: 995805380

View in Genome Browser
Species Human (GRCh38)
Location 5:116046550-116046572
Sequence TGAGGCCTCCACACCTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995805376_995805380 -3 Left 995805376 5:116046530-116046552 CCCTCAAGGGATGTGGTTCCTGA 0: 1
1: 0
2: 1
3: 8
4: 127
Right 995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG No data
995805377_995805380 -4 Left 995805377 5:116046531-116046553 CCTCAAGGGATGTGGTTCCTGAG 0: 1
1: 0
2: 1
3: 14
4: 133
Right 995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG No data
995805373_995805380 9 Left 995805373 5:116046518-116046540 CCTGGTGCCATTCCCTCAAGGGA 0: 1
1: 0
2: 0
3: 16
4: 131
Right 995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG No data
995805375_995805380 2 Left 995805375 5:116046525-116046547 CCATTCCCTCAAGGGATGTGGTT 0: 1
1: 0
2: 0
3: 15
4: 191
Right 995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995805380 Original CRISPR TGAGGCCTCCACACCTTGCC AGG Intronic
No off target data available for this crispr