ID: 995805801

View in Genome Browser
Species Human (GRCh38)
Location 5:116051238-116051260
Sequence TCTCCTGGAACCCCCGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995805796_995805801 30 Left 995805796 5:116051185-116051207 CCTGCTTAAGAGAGGTTTATGAT 0: 1
1: 0
2: 0
3: 9
4: 95
Right 995805801 5:116051238-116051260 TCTCCTGGAACCCCCGGCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995805801 Original CRISPR TCTCCTGGAACCCCCGGCAG AGG Intronic