ID: 995805801

View in Genome Browser
Species Human (GRCh38)
Location 5:116051238-116051260
Sequence TCTCCTGGAACCCCCGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995805796_995805801 30 Left 995805796 5:116051185-116051207 CCTGCTTAAGAGAGGTTTATGAT 0: 1
1: 0
2: 0
3: 9
4: 95
Right 995805801 5:116051238-116051260 TCTCCTGGAACCCCCGGCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995805801 Original CRISPR TCTCCTGGAACCCCCGGCAG AGG Intronic
900130222 1:1084220-1084242 TCTCCTGGGGACCCGGGCAGGGG + Intronic
900420727 1:2554930-2554952 CCTCCTGGGGCCCCCGGGAGTGG + Intergenic
901175112 1:7293261-7293283 TCTCCAGGAGCTCCCGCCAGAGG + Intronic
901316458 1:8313073-8313095 CCTCCTGCAACACCTGGCAGAGG - Intergenic
908383370 1:63617406-63617428 TCTCCTGCAGCCACAGGCAGTGG + Intronic
910510797 1:88001896-88001918 TGGCCTGGACCCCTCGGCAGGGG + Intergenic
911660501 1:100496520-100496542 TCCCCTGAAACCTCCGGGAGTGG + Intronic
912455539 1:109794366-109794388 TCTCCTGGAACATCCTGTAGTGG + Intergenic
915905304 1:159872776-159872798 TCTGCTGGAGCCCCCTTCAGAGG + Intronic
921214969 1:212928902-212928924 TGTCCAGGAAACCCCCGCAGAGG + Intergenic
923729920 1:236540233-236540255 TCGCCTGGAAGCCCAGGCACAGG - Intronic
924230501 1:241958345-241958367 TCTCCAGGCAGCCCAGGCAGAGG + Intergenic
1063459066 10:6203954-6203976 TCTCCTGGCGCCCCCAGCACGGG - Intronic
1069553865 10:69383823-69383845 CCTCCTGGAAGCCCAGGCTGGGG + Intronic
1069960013 10:72073980-72074002 CCTCCTGGAGCCCCACGCAGAGG - Intronic
1073249887 10:102114842-102114864 TCTCCTGGTGCCCCCAGCAGAGG - Intronic
1073678725 10:105679145-105679167 TCTCCTGCATCCCCCAGCAGTGG + Intergenic
1076331875 10:129676081-129676103 TCTCCTGTAACTCCCAGGAGTGG + Intronic
1076677360 10:132154005-132154027 ACTGCTGGAACCCCGGGGAGGGG + Intronic
1077026157 11:440988-441010 TCTCCTCTAACCCCCAGCATGGG + Intronic
1077406934 11:2386885-2386907 TTCCCTGCAACCCTCGGCAGAGG + Intronic
1078390204 11:10930822-10930844 TCTGCTGGAAGCTTCGGCAGCGG + Intergenic
1079034707 11:17012107-17012129 TCTCCTGCCTCCCCCTGCAGTGG + Intronic
1079571708 11:21952078-21952100 TCTCCTCCATCCCCCAGCAGTGG + Intergenic
1081436800 11:43035553-43035575 TTTCCTGATACCCCCAGCAGAGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081584036 11:44371987-44372009 TCTCCTGGAACACCAGGGTGGGG - Intergenic
1081668262 11:44929157-44929179 TCTACTGGATGCCCCGGAAGAGG - Exonic
1083312594 11:61792429-61792451 GCTCCTGGAACCTCCGGCTTGGG - Intronic
1084207760 11:67605953-67605975 TTTCCTGGAACCCTCTGCTGTGG - Exonic
1084964676 11:72738471-72738493 TTTCCTTGAACCCAGGGCAGAGG - Intronic
1085771759 11:79331748-79331770 CTTCCTGCAACCCCGGGCAGGGG + Intronic
1089523109 11:119078783-119078805 TCTGCTGGAACCTGCGGCCGGGG - Exonic
1090613120 11:128489477-128489499 TTTCCTCAGACCCCCGGCAGTGG - Exonic
1090619644 11:128549407-128549429 TCTCCTGGAACTCCTCGCACGGG - Intronic
1090830043 11:130414803-130414825 TCTCCTGGATGCCCCTGCTGCGG - Exonic
1090978743 11:131697956-131697978 ACTCCTGGAGCCCCTGACAGAGG - Intronic
1092505118 12:9090776-9090798 TCCCCCGGATCTCCCGGCAGAGG + Intronic
1094375568 12:29784248-29784270 CCTCCTGGGTCCCCCGGGAGGGG - Intronic
1096134487 12:49188387-49188409 TCTGCCGGAGCCCCCGGCAGCGG - Intronic
1101587207 12:106095363-106095385 ACCCCTGGAAACCCTGGCAGAGG + Intronic
1101732357 12:107437254-107437276 TCTCCTGGAACCTCTGGAATGGG - Intronic
1102698446 12:114818008-114818030 TCTCCTGGAGCAGCTGGCAGGGG + Intergenic
1102736324 12:115163777-115163799 TCTCCTGCAAACTCCGGCATTGG + Intergenic
1103339504 12:120213979-120214001 TCTCGTGGAACCCTGGGGAGCGG + Exonic
1104943877 12:132407152-132407174 TCTCCAGGATCCATCGGCAGTGG + Intergenic
1105600151 13:21879336-21879358 TCTCCAGGAACCCCAGACACTGG - Intergenic
1107672686 13:42762201-42762223 TCTCCTGGATGGCCCAGCAGTGG - Intergenic
1107730382 13:43342509-43342531 TCTCCTGGAAACCACAGGAGTGG - Intronic
1108533598 13:51349200-51349222 CCTACTGGAAGCCCAGGCAGTGG - Intronic
1112467030 13:99653448-99653470 TCACCTGTAACTCCTGGCAGGGG + Intronic
1113753340 13:112791498-112791520 GGTCCTGGTACCCCTGGCAGGGG + Intronic
1114920917 14:27327697-27327719 TCTCCTGGTGCTACCGGCAGGGG - Intergenic
1121010025 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG + Intergenic
1121303472 14:92890158-92890180 CCTCCTAGAACCCCAGGAAGTGG - Intergenic
1122152506 14:99732571-99732593 TCTCTTTGAACCCAAGGCAGTGG + Intergenic
1122544264 14:102513511-102513533 TTTCCTGGAAGCCCCGGCTGGGG - Intergenic
1122940301 14:104978182-104978204 TGGCCCGGAACCCCCGGCAGCGG - Exonic
1127774495 15:62254539-62254561 ACCCCTGGAGCCCCCAGCAGGGG - Intergenic
1128370042 15:67033794-67033816 TCTCCTGGAAGCCCATGCAGAGG - Intergenic
1129875874 15:78975121-78975143 ACTCCTGTAATCCCAGGCAGTGG + Intronic
1132649771 16:1015218-1015240 TCTTCTGGAAACCTCTGCAGTGG - Intergenic
1134358551 16:13507579-13507601 GGTCCAGGAACCCCCGGCATTGG - Intergenic
1136933307 16:34437163-34437185 ACTCCAGGACCCCCAGGCAGGGG - Intergenic
1136971265 16:34974651-34974673 ACTCCAGGACCCCCAGGCAGGGG + Intergenic
1137785860 16:51137278-51137300 ATTCCTGGAAGCCTCGGCAGTGG - Exonic
1141430957 16:83969904-83969926 GCTCCTGGAACCCTTGGCCGGGG + Intronic
1141470611 16:84235972-84235994 TCTCCTGTAACTCCCTGCAAAGG + Intronic
1141912604 16:87070354-87070376 TCTCCTGCCAAACCCGGCAGGGG - Intergenic
1144642362 17:16944635-16944657 TCTCGTGGAAGGCCAGGCAGTGG - Intronic
1144670780 17:17131530-17131552 ACTCCTGGACCACCCGGCAAGGG + Intronic
1145241154 17:21241705-21241727 TCTCCTCGAAACCCCTGCTGTGG - Exonic
1146909849 17:36641633-36641655 GCTCCTGGAACACAAGGCAGTGG - Intergenic
1147905620 17:43820863-43820885 TCTCCTGGAACCCCTTGGAGGGG + Exonic
1149990189 17:61378843-61378865 GCTACTGGAAGCCCCGCCAGGGG + Intronic
1151595756 17:75077282-75077304 CCTCCTGGAGCCCCTGACAGGGG + Intergenic
1152858115 17:82677752-82677774 TCTGCTGGAACCCCCGGATGTGG + Intronic
1154218105 18:12430162-12430184 TCTCCTTGAACCCAAGCCAGGGG + Intronic
1155498444 18:26464779-26464801 GCTCTTGGGACCCTCGGCAGTGG + Intronic
1157487104 18:48095795-48095817 TCTCCTGTAACCCACGGCTGAGG + Intronic
1157588233 18:48818750-48818772 TGTCCTGGTAGCCCCTGCAGAGG - Intronic
1161108368 19:2455626-2455648 TCTCCTGGGACCCCCTCCATAGG + Intronic
1161248361 19:3267506-3267528 TCTCCAGGAACCCCAGGCTCTGG - Intronic
1161437637 19:4273220-4273242 TCTCCTGTAAGCCCAGGCTGGGG - Intergenic
1161694375 19:5757860-5757882 TGGCCTGGAACCCCAGGGAGTGG - Exonic
1162281343 19:9700355-9700377 TCTCCAGGACCCCCAAGCAGGGG + Intronic
1163332972 19:16653141-16653163 TCTCCTGGCAGCCCCTGCAGAGG + Intronic
1163435474 19:17292671-17292693 TCTTCTGGAGGCGCCGGCAGTGG + Exonic
1163703389 19:18798533-18798555 TCTCCTGGAGCCTTAGGCAGCGG - Intergenic
1164553790 19:29234229-29234251 TCTTCTGGAAGCCCCAGGAGAGG - Intergenic
1165116985 19:33534418-33534440 TCTACTGGAAGCCAGGGCAGAGG - Intergenic
1165956402 19:39504346-39504368 TCTCATGGAGCCCCAGGGAGAGG - Intronic
1166391295 19:42410303-42410325 TCACCTGGAAGCCCAGGCAGCGG + Exonic
1166392823 19:42419481-42419503 TCGCCAGGAATCCCTGGCAGAGG + Intronic
1168254290 19:55157413-55157435 ACTCCTGGAACCCAAGGAAGGGG - Intronic
1168667942 19:58218426-58218448 TCTCTAGGCACGCCCGGCAGGGG + Intergenic
926224992 2:10961172-10961194 TCTCCTGGAACCTAAGACAGAGG + Intergenic
931204905 2:60137560-60137582 CCACATGGAACCCCCTGCAGGGG + Intergenic
932222747 2:70012127-70012149 TCTCTTGGATCCCCCGGGAAGGG - Intergenic
938116674 2:128607079-128607101 TCTCTTGGAACCCCAGGCCCAGG + Intergenic
942189688 2:173457481-173457503 CTTCCCGGAACCCCAGGCAGAGG + Intergenic
945006882 2:205417847-205417869 TCTCCGGGAACCCCCAGTGGAGG + Intronic
1168793052 20:592853-592875 ACTCCTGGAAACCCCGTCCGTGG - Intergenic
1168960620 20:1866905-1866927 TCTTCTGCATCCCCCGGCAGAGG - Intergenic
1170952871 20:20952640-20952662 TCTCCTGGAACCCTGTGAAGAGG + Intergenic
1172277576 20:33688208-33688230 TCTCCTGGCAACCCTGGAAGGGG - Intergenic
1172442848 20:34978044-34978066 TCTCCTGGTAGCCCTGGCGGAGG - Exonic
1172599023 20:36170906-36170928 TCTGCTGGAGACCCAGGCAGAGG + Intronic
1174174600 20:48636770-48636792 CCTCATGGAACCCCCAGCAAAGG + Intronic
1175715005 20:61249532-61249554 TCTCCAGCTACCCCAGGCAGAGG + Intergenic
1175782929 20:61695248-61695270 TGGCCTGTAACCTCCGGCAGAGG - Intronic
1176899219 21:14419598-14419620 CCTTATGTAACCCCCGGCAGTGG + Intergenic
1178453782 21:32728216-32728238 TCTCCCTGCACCCCCGGCGGTGG - Intergenic
1179036960 21:37766582-37766604 TCTGATGGGACCCCGGGCAGTGG + Intronic
1180147205 21:45928230-45928252 TCTCCTGGCACCCTCGTCAGGGG + Intronic
1180225820 21:46391501-46391523 TCTCCTGGAACACTGGGCATGGG + Intronic
1181629150 22:24141461-24141483 TGTCCTGGAGACCCCGGCACAGG - Intronic
1182280379 22:29214859-29214881 CCTCCTGGAGTCCCCAGCAGGGG + Intronic
1182356419 22:29724161-29724183 ACTCAGGGAGCCCCCGGCAGAGG + Intronic
1184224908 22:43124082-43124104 GCTCCTGGAACCCCCGACCATGG + Exonic
1184986430 22:48139304-48139326 TCCCCTGAGACCCCAGGCAGAGG - Intergenic
953929564 3:46999162-46999184 CCTCCCTGAACCCCAGGCAGGGG - Intronic
957434115 3:80151961-80151983 TCTCCAGTAACCCCAGCCAGAGG - Intergenic
959968796 3:112385190-112385212 TCCCCTGCAGCCCCCTGCAGTGG + Intergenic
961861022 3:129916851-129916873 TCTCAGGGAGCCCCAGGCAGAGG - Intergenic
962108481 3:132417606-132417628 GCACCAGGAACCCGCGGCAGCGG + Exonic
966914353 3:184576767-184576789 TGTGCTGGAACTCCGGGCAGAGG + Intronic
966933122 3:184688565-184688587 TCTCCTGGCAGCTCCTGCAGGGG - Intergenic
967082840 3:186066010-186066032 TCTCCAGGAACTCCTGGCTGAGG + Exonic
968085518 3:195872286-195872308 TGTCCGGGAAGCCCCAGCAGTGG + Exonic
968621025 4:1603540-1603562 CCTCCTGGGACCATCGGCAGAGG - Intergenic
970106537 4:12592210-12592232 ACTCCAGGAACCCCGGACAGTGG - Intergenic
977303618 4:95296976-95296998 TCTCCTGGAATCACCCTCAGTGG + Intronic
982399191 4:154947132-154947154 TCTCCTGGATCCCTAGCCAGAGG - Intergenic
983647347 4:170005102-170005124 TCTCCAGGAATCCCAGCCAGTGG + Intronic
984590172 4:181608343-181608365 TCTCCTGGAACCTCTTGGAGAGG - Intergenic
985537581 5:473603-473625 TGTCCCGGGACCCCCGGCGGGGG - Intronic
985881681 5:2643073-2643095 TCTCCAGAGACCCCAGGCAGCGG - Intergenic
990511625 5:56494342-56494364 TCTCCTGGCACCCCAGGGAACGG + Intergenic
992452008 5:76883869-76883891 TCTGGAGGAACCCCTGGCAGTGG + Intronic
995805801 5:116051238-116051260 TCTCCTGGAACCCCCGGCAGAGG + Intronic
1001587856 5:172845358-172845380 CTTCCTGGCTCCCCCGGCAGGGG - Intronic
1002721339 5:181262845-181262867 ACTCCTGTAGCCCCCTGCAGTGG + Intergenic
1003128762 6:3377448-3377470 CCTCCTGGACCCTCTGGCAGGGG + Intronic
1003517648 6:6831055-6831077 TCTCCTGGAAACTCCTGCAGAGG + Intergenic
1003533870 6:6959148-6959170 TCTCCTGGAACCCCCAACTTGGG - Intergenic
1006683046 6:35811011-35811033 TCTCCTGGGACCCTCGCTAGTGG + Intronic
1006878481 6:37318686-37318708 CCTCCTGGAACCCCTGGGTGGGG + Intronic
1013599370 6:111690156-111690178 TCTCCTGTGACCCCCGACATAGG - Intronic
1014752131 6:125268361-125268383 TCTGGTGGAAACCCGGGCAGTGG + Intronic
1015692481 6:135940289-135940311 TCTCCAGTAACCCCAGTCAGGGG + Intronic
1015860488 6:137673434-137673456 TCTCCTGGAATCCAAGGAAGAGG - Intergenic
1016525506 6:144997745-144997767 TCCCCTGGAACCTCAGGCAGTGG - Intergenic
1018951442 6:168381068-168381090 TCTCCTGGAGCCTCCAGAAGGGG - Intergenic
1019272484 7:158123-158145 TCTCCAGGGACACCTGGCAGAGG - Intergenic
1019621683 7:1995546-1995568 TCTCCTGGGCCCCCCGCCTGGGG - Intronic
1019687310 7:2388901-2388923 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687333 7:2388989-2389011 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687371 7:2389116-2389138 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687382 7:2389157-2389179 CCTCCTGGAACCCCTGGCATGGG - Intergenic
1019687405 7:2389239-2389261 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687443 7:2389366-2389388 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1019687595 7:2390378-2390400 CCTCCTGGAACCCCTGGGATGGG - Intergenic
1020186470 7:5962849-5962871 TCTCGGGAAACTCCCGGCAGGGG - Intronic
1020296444 7:6761925-6761947 TCTCGGGAAACTCCCGGCAGGGG + Intronic
1023351322 7:39322884-39322906 TCTCCTAGAACCCTGAGCAGTGG + Intronic
1024325681 7:48107558-48107580 TCTCCTGGAGCCCCTCGCTGGGG + Intronic
1026805771 7:73429122-73429144 CCTCCTGGGACCCCTGGCTGGGG - Intergenic
1032084523 7:128877051-128877073 TCTCCTGGGGCTCCCGGCTGGGG + Exonic
1034265261 7:149777628-149777650 CCTCCTGCAGCCCCTGGCAGGGG + Intergenic
1034530927 7:151696109-151696131 GCTCCTGGCAGCCCTGGCAGGGG - Intronic
1041582974 8:59483905-59483927 CCTCCCCGAACCCCCAGCAGAGG - Intergenic
1042739711 8:72029688-72029710 TCTCCTGGGATGCCGGGCAGTGG + Intronic
1045361011 8:101433216-101433238 TCTCCTTGATCCCCCGGCCCTGG + Intergenic
1045517594 8:102873991-102874013 TCTCCTGGAACCCCAGTTACTGG - Intronic
1048858257 8:138702464-138702486 TCTCCTGGCATCCCCTGCAAGGG + Intronic
1049230931 8:141480788-141480810 CCTCCTGGCACCCACCGCAGAGG - Intergenic
1049542115 8:143213382-143213404 CCTCCAGGGACCCCCAGCAGGGG + Intergenic
1055429254 9:76227300-76227322 ACTTCTGGAGCCCCCGGGAGAGG + Intronic
1058562682 9:106246544-106246566 TCTCCTGGAACCTCCAGAAAAGG - Intergenic
1060219699 9:121757931-121757953 TCTCCTGGCACCCCCAGCCCTGG + Intronic
1060818798 9:126650073-126650095 TCTCCTACATCCCCCAGCAGAGG + Intronic
1062027101 9:134345597-134345619 GCTGCTGGTAGCCCCGGCAGAGG + Intronic
1189746784 X:44176827-44176849 TCACCTGGAAGCCCCAGCTGGGG + Intronic
1190634554 X:52420825-52420847 GGGCCTGGAACCCCCGACAGAGG + Intergenic
1190648365 X:52544213-52544235 ACCCCTGGAACCCCCAACAGAGG + Intergenic
1195656681 X:107337919-107337941 TCTCCAGGAAGCCCAGTCAGAGG - Intergenic
1196463852 X:115953329-115953351 TCACGTGGTAGCCCCGGCAGGGG + Intergenic
1196733455 X:118963798-118963820 GCTCCTGGAAGCCACGGGAGGGG + Intergenic
1196745733 X:119070438-119070460 TCTCATGGAAGCCACGGGAGGGG - Intergenic
1198446771 X:136725161-136725183 TCTGCTGGAACCACTGGCATAGG + Intronic
1201352137 Y:13055493-13055515 TCTCCTGGGTCCCTTGGCAGAGG - Intergenic