ID: 995805836

View in Genome Browser
Species Human (GRCh38)
Location 5:116051586-116051608
Sequence GGGGGCACTCCCCAGTAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995805836_995805847 17 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805847 5:116051626-116051648 GCCCATGGATGTGGGTGGGAAGG 0: 1
1: 0
2: 2
3: 38
4: 393
995805836_995805846 13 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805846 5:116051622-116051644 AGATGCCCATGGATGTGGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 199
995805836_995805852 27 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805852 5:116051636-116051658 GTGGGTGGGAAGGTGGGCCCAGG 0: 1
1: 0
2: 8
3: 95
4: 665
995805836_995805842 2 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805842 5:116051611-116051633 GAGGATCTCTGAGATGCCCATGG 0: 1
1: 0
2: 1
3: 32
4: 271
995805836_995805845 12 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805845 5:116051621-116051643 GAGATGCCCATGGATGTGGGTGG 0: 1
1: 1
2: 1
3: 27
4: 249
995805836_995805850 20 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805850 5:116051629-116051651 CATGGATGTGGGTGGGAAGGTGG 0: 1
1: 1
2: 11
3: 89
4: 761
995805836_995805844 9 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805844 5:116051618-116051640 TCTGAGATGCCCATGGATGTGGG 0: 1
1: 0
2: 0
3: 15
4: 152
995805836_995805851 21 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805851 5:116051630-116051652 ATGGATGTGGGTGGGAAGGTGGG 0: 1
1: 0
2: 4
3: 77
4: 626
995805836_995805843 8 Left 995805836 5:116051586-116051608 CCATGCTACTGGGGAGTGCCCCC 0: 1
1: 0
2: 1
3: 6
4: 114
Right 995805843 5:116051617-116051639 CTCTGAGATGCCCATGGATGTGG 0: 1
1: 0
2: 0
3: 24
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995805836 Original CRISPR GGGGGCACTCCCCAGTAGCA TGG (reversed) Intronic
900504505 1:3022593-3022615 GGGGGCACTACCCTGTTCCACGG + Exonic
906950860 1:50333574-50333596 GGGGCCACACCACATTAGCACGG + Intergenic
910546296 1:88423000-88423022 GCCTGCCCTCCCCAGTAGCAAGG + Intergenic
911275349 1:95852958-95852980 GGAAGCACTCCCCATTGGCAGGG + Intergenic
912324677 1:108746631-108746653 TGGGGCATTCCCCTGCAGCAAGG + Intergenic
913254795 1:116943914-116943936 GGGGCCACTACCAAGCAGCAGGG - Intronic
915931360 1:160062530-160062552 GGGGGCACTGCCCAGGAGACAGG + Intronic
920298716 1:204975575-204975597 GGGGGGTCTCCCCTGAAGCAGGG - Intronic
920705917 1:208250436-208250458 GGGGGCATTCTCCTGTGGCAGGG - Intergenic
922484447 1:225962473-225962495 GAGGGCACTGCCCAGGAGCCTGG - Intergenic
1062851338 10:745109-745131 TGGGACACTCCCTAGTAGCTGGG - Intergenic
1062950632 10:1500150-1500172 GGAGGCACTGCTCAGAAGCAGGG - Intronic
1070630720 10:78082554-78082576 GGCGGCCCTGCCCAGTAGCAAGG - Intergenic
1073623804 10:105075551-105075573 GGTGTCACTCCCCATCAGCAAGG - Intronic
1073817995 10:107228660-107228682 GGGTGCACTCCCCTGTGGCTCGG + Intergenic
1074847395 10:117410395-117410417 GGGGGTACTCCACAGGACCAAGG - Intergenic
1075680209 10:124326038-124326060 GGGGGCCCCTCCCAGTAGCCAGG - Intergenic
1076640291 10:131911274-131911296 GGGACCTCTCCCCAGCAGCAAGG - Intronic
1083737934 11:64692343-64692365 GGGGGCCTCCCACAGTAGCAAGG + Intronic
1084562735 11:69913621-69913643 GGGGGCACTTGCCAGGAGCCAGG + Intergenic
1087400177 11:97655178-97655200 GTGGGCAATCCCAAGTAGCTGGG - Intergenic
1088795498 11:113264002-113264024 GGGTGAACTCCCAAGCAGCAGGG - Intronic
1091388882 12:113049-113071 GGGGGCACTTCCCAGTGTCCAGG - Intronic
1091922814 12:4319670-4319692 TGGGGCACTACACAGCAGCAGGG - Intergenic
1096032722 12:48434500-48434522 GGAGGCATCCCCCAGTAGGAGGG + Intergenic
1096256253 12:50063937-50063959 GGGTGCAGACCCCAGTAGTAAGG - Intronic
1099230121 12:80013968-80013990 GGGGGCAGTCCTCAGTGGCCTGG + Intergenic
1102329571 12:112017406-112017428 TGGAGGAGTCCCCAGTAGCAGGG + Intronic
1104771402 12:131366860-131366882 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771480 12:131367130-131367152 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771497 12:131367184-131367206 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771514 12:131367238-131367260 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771530 12:131367292-131367314 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771562 12:131367400-131367422 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771576 12:131367453-131367475 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1113957187 13:114105173-114105195 TGGGGCTCTCCCCAGGAGGAGGG + Intronic
1114710941 14:24777580-24777602 GGAGGCACCCCCCAGATGCAGGG + Intergenic
1122160576 14:99781320-99781342 GGAGGCACACCCCATGAGCAAGG - Intronic
1122809610 14:104281495-104281517 GGGGGCACACAACAGCAGCAGGG - Intergenic
1125709664 15:41774629-41774651 GGGGGCGCTGACGAGTAGCAGGG + Intronic
1125755093 15:42058084-42058106 CGAGGCAATCCCCAGTGGCAAGG + Intergenic
1127147176 15:56036135-56036157 GGGAGCAGCCCCCAGTAGCCAGG - Intergenic
1128699813 15:69795990-69796012 GGGGGTCCTCCCCAGCAGCTAGG - Intergenic
1131148852 15:90034570-90034592 GAGGGCCCTCCCTAGCAGCAGGG + Intronic
1134609593 16:15597837-15597859 GGGGGCACTGCACAGGAGCAGGG + Intronic
1141039605 16:80661538-80661560 GCTGGCACTTCCCAGTGGCATGG - Intronic
1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG + Intronic
1141659583 16:85434892-85434914 AGGGGCCCACCCCAGTAGGACGG - Intergenic
1142005584 16:87688139-87688161 GTGGTCACTCCCCAGAAACAGGG - Intronic
1142125642 16:88409015-88409037 GGGGGCCCTCCCTAGCTGCAGGG + Intergenic
1143113442 17:4566943-4566965 AGGGGAAGTCCCCCGTAGCAGGG + Intergenic
1143683485 17:8494977-8494999 GGGAGAAATCCCGAGTAGCAAGG + Intronic
1146011309 17:29196957-29196979 TGGGGCACTCACCAGCAGGAGGG + Intergenic
1146787604 17:35732628-35732650 AGGGGCACTACCCAGGAGCTAGG - Intronic
1147262485 17:39216798-39216820 GGGGGCACTCACCAGTGGGTGGG + Exonic
1152567077 17:81105097-81105119 GGGGTCTCCCCCCAGTGGCAGGG + Intronic
1159908921 18:74125147-74125169 GGTGCCACTCTCCAGTAGCCAGG + Intronic
1161777987 19:6274185-6274207 GGGGGCACTCCCCGGAAGGGTGG + Intronic
1162819898 19:13216272-13216294 TGGTGCACACCCCATTAGCAAGG - Intronic
1164600926 19:29562746-29562768 GTGGGCTTTCCCCAGTTGCACGG + Intronic
1164674384 19:30091868-30091890 GGGGCCACACTCCAGCAGCAAGG - Intergenic
1164844566 19:31420851-31420873 GGTGGCACTTTCCAGAAGCATGG + Intergenic
1166843581 19:45713015-45713037 CGGGGCCCTCCTCAGCAGCAGGG + Exonic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
931429903 2:62200323-62200345 GGGGGAAATTCCCAGTAGCCAGG + Intronic
934941575 2:98506824-98506846 GCGGGCACTCCCCTGTGGCAGGG + Intronic
937287481 2:120762451-120762473 GGGCTCTCTCCCCAGTACCAGGG + Intronic
938248411 2:129796315-129796337 GGGTGCCCTGCCCAGTTGCAGGG + Intergenic
947709840 2:232306767-232306789 CTGGGCACTCCTCAGCAGCAAGG + Intronic
1171377010 20:24700486-24700508 AGGGGAACTCCCCTGTACCAAGG - Intergenic
1175337286 20:58204924-58204946 GGGGGCACACCCCAGAAAAATGG - Intergenic
1179317806 21:40260417-40260439 TGGGTCACTGCCCTGTAGCATGG + Intronic
1181674314 22:24441836-24441858 GGAGCCACTCCCCAGTCTCAGGG - Exonic
1181799251 22:25333670-25333692 TGCAGCACTCCCGAGTAGCAGGG + Intergenic
1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG + Intronic
1182688779 22:32141448-32141470 GGCAGCGCTCCCGAGTAGCAGGG - Intergenic
1184286215 22:43473214-43473236 CGGGGCAATGCCCAGCAGCACGG - Intronic
950883736 3:16345010-16345032 GGGGGCAGCCCCCAGGAGCAAGG + Intronic
953200420 3:40773301-40773323 GTGGGCTCTCACTAGTAGCAGGG - Intergenic
954613323 3:51957551-51957573 GGGGGCACTGCCAGGTAGCTGGG - Exonic
968782637 4:2594596-2594618 GGAGGCACTCCCAGGGAGCAGGG - Intronic
972426532 4:38938233-38938255 GGGGGCATGCCCCAGAAGCCAGG - Intronic
977234855 4:94495735-94495757 GGGGGTACACACCAGAAGCAAGG + Intronic
986977571 5:13410819-13410841 TGAGGCACTCCCCAGTAGCTTGG - Intergenic
995778881 5:115755120-115755142 AGGAGCACTCCTCACTAGCATGG - Intergenic
995805836 5:116051586-116051608 GGGGGCACTCCCCAGTAGCATGG - Intronic
997721421 5:136080869-136080891 GGGGGTACTCCTCAGCAGCCTGG - Intergenic
998340195 5:141410362-141410384 GGAAGCAGTCCCAAGTAGCAGGG - Exonic
999106495 5:149075523-149075545 TGAGCCACTCCCCAGTAGCTTGG - Intergenic
1001514712 5:172347250-172347272 GTGGCCACTCCCCAGTAGCGAGG + Intronic
1004668154 6:17768533-17768555 GGGCTCACTCCTCAGTACCATGG - Intronic
1005020442 6:21412965-21412987 GGGATCACTCCCCAGCAGCCAGG - Intergenic
1006311434 6:33263971-33263993 GGAGACACTTCCCAGCAGCAGGG - Intronic
1009318900 6:62260089-62260111 TGGGACACTCCCTAGTTGCATGG + Intronic
1009458398 6:63883651-63883673 GGAGGCAGTCCCAAGGAGCAAGG - Intronic
1015450141 6:133357709-133357731 GGAGGCACTCCACACAAGCAGGG + Intronic
1017958378 6:159199244-159199266 GGGTGCCCTCCCCTGTAACATGG + Intronic
1019889399 7:3934023-3934045 GGGGGCATTCACCAGCCGCACGG + Intronic
1020702927 7:11506105-11506127 GGGGGCCCTCCCCAGTAGCTGGG + Intronic
1021661665 7:22924920-22924942 GGAGGCACCCCCCAGTAGGCGGG + Intergenic
1022862276 7:34379901-34379923 AGAAGCACTCCCCTGTAGCAGGG - Intergenic
1026491331 7:70866394-70866416 GGAGACACTCCCCAGAAACAAGG + Intergenic
1028411651 7:90536825-90536847 GGGGCCACTCTCCATCAGCAGGG + Intronic
1030103329 7:105965597-105965619 AGGAGCACTCCCCAGGAGCTAGG - Intronic
1035074639 7:156169587-156169609 GGGTTCCCTCCCCAGGAGCAGGG - Intergenic
1049394660 8:142394295-142394317 GTGGGCACCCCACAGCAGCAGGG + Intronic
1049791425 8:144474392-144474414 GGGGCCACCCCCCAGTAGGCAGG + Exonic
1049831508 8:144704282-144704304 GGGGTCTCTCCCCAGCAGCTGGG - Intergenic
1057618987 9:96619036-96619058 GGGGGCGCTCCTCAGGAGCCAGG + Intronic
1059486846 9:114633711-114633733 CTGGGAGCTCCCCAGTAGCATGG + Intronic
1062076159 9:134591022-134591044 GGTGGCAGTTCCCAGGAGCAGGG + Intergenic
1186077537 X:5897583-5897605 GGGGATCCTCCCCTGTAGCAAGG - Intronic
1189285432 X:39848913-39848935 AGGGGCACTCACCAGTGGTAGGG + Intergenic
1189480911 X:41391602-41391624 GGGAGCTCTCCCTGGTAGCAGGG + Intergenic
1191250077 X:58256024-58256046 GGGGGCACCCCAAAGCAGCAAGG + Intergenic
1191251327 X:58261498-58261520 GGGGGCACCCCAAAGTGGCAAGG + Intergenic
1192503252 X:71666623-71666645 GGGGGCACCACACAGCAGCAAGG - Intergenic
1199987457 X:152962930-152962952 GGGGACAATACCCAGTAGCCTGG + Intronic
1200185777 X:154182473-154182495 GGGGGCTCGCCTCAGGAGCAAGG + Intergenic
1200191429 X:154219611-154219633 GGGGGCTCGCCTCAGGAGCAAGG + Intergenic
1200197184 X:154257415-154257437 GGGGGCTCGCCTCAGGAGCAAGG + Intergenic
1201517775 Y:14836126-14836148 GGGGATTCTCCCCTGTAGCAAGG + Intronic