ID: 995817456

View in Genome Browser
Species Human (GRCh38)
Location 5:116187927-116187949
Sequence CTGTAATCACAGAAGCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 311}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995817451_995817456 24 Left 995817451 5:116187880-116187902 CCATGTGTCTTGGGTAGAATTCT 0: 1
1: 0
2: 0
3: 22
4: 430
Right 995817456 5:116187927-116187949 CTGTAATCACAGAAGCAGTTTGG 0: 1
1: 0
2: 2
3: 75
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995817456 Original CRISPR CTGTAATCACAGAAGCAGTT TGG Intronic
900468579 1:2838613-2838635 CTGTAATTCCAGCAGCACTTTGG - Intergenic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900796288 1:4710658-4710680 CTGTAATGACTGAAGCGGGTGGG - Intronic
901685983 1:10943614-10943636 ATGTAACCAGAGAAGCAGTGTGG - Intergenic
902055777 1:13599267-13599289 CTGTAATCCCACCAGCACTTTGG - Intronic
902309451 1:15569905-15569927 CTGTAATCCCAGCAGCACTTTGG - Exonic
904648865 1:31989158-31989180 CTGTAATCCCAGCAGCACTTTGG - Intergenic
907147751 1:52251699-52251721 CTGGCTTCACAGAAGGAGTTAGG + Intronic
908153660 1:61329970-61329992 CAGGAATCACAGAAGCGGTGGGG + Intronic
908388985 1:63668427-63668449 CTGTAAACACTGAAACAGCTGGG + Intergenic
910382404 1:86642606-86642628 GTGCAATCACAGAAGCACATGGG + Intergenic
910755466 1:90685674-90685696 CTGTAATCACAGCAGCACTTTGG + Intergenic
912898927 1:113626465-113626487 CTGGCATCACAGAATGAGTTTGG + Intronic
913006778 1:114641171-114641193 CTGTAATCCCAGTACCTGTTGGG + Intronic
913329668 1:117656588-117656610 GTGTAAACACAGTAGCACTTGGG - Intergenic
913480486 1:119284104-119284126 CTCTAATTACAGGAGCAATTTGG + Intergenic
914426259 1:147579822-147579844 CTCGAACCACAGCAGCAGTTAGG + Intronic
915102788 1:153512891-153512913 CTATAATCAAAGCTGCAGTTAGG + Intergenic
915413551 1:155722143-155722165 CTGTAATCCCAGCTGCACTTTGG + Intronic
915442522 1:155954228-155954250 CTTTAATCCCAGAAGGATTTGGG - Intronic
915578959 1:156801895-156801917 CAGTATTCACAGAGGCAGTGGGG + Intergenic
918659425 1:187071667-187071689 CTGTAATCCCAGCAGCACCTTGG - Intergenic
918666438 1:187156487-187156509 CTGGACTCACAGAATGAGTTAGG + Intergenic
919433692 1:197530600-197530622 CTCTAATCACTAAAGTAGTTAGG - Intronic
921197262 1:212770681-212770703 CTGTTCTCACAGAATGAGTTAGG - Intronic
921363333 1:214350817-214350839 CTGTAATCAAACCAGCACTTTGG - Exonic
923656990 1:235925606-235925628 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063595108 10:7427843-7427865 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1066066153 10:31762321-31762343 CTGTAATCCCAGCACCACTTTGG + Intergenic
1067120538 10:43468727-43468749 CTGTAATCCCAGCACCACTTTGG + Intronic
1067670950 10:48320495-48320517 CTCTAATCTCAGCAGCACTTTGG - Intronic
1069420941 10:68246032-68246054 CTGTAATCGCAGCAGCATTTTGG + Intergenic
1069905527 10:71730092-71730114 CTGTAATCCCAGCAGCACTTTGG - Intronic
1071255280 10:83866702-83866724 CTGAGATCAAAGAAGCAGTCAGG - Intergenic
1072654827 10:97322610-97322632 CTGTAATCCTAGTAGCACTTTGG + Intergenic
1072954321 10:99875330-99875352 CTGTAATCCCACCAGCACTTTGG - Intergenic
1073455350 10:103633463-103633485 CTGTAATCCCTGTAGCACTTTGG + Intronic
1075172936 10:120132757-120132779 ATTAAATCAGAGAAGCAGTTTGG - Intergenic
1076398691 10:130162238-130162260 CTATAATCCCAGCAGCACTTTGG - Intronic
1078538561 11:12195002-12195024 CTATAATCCCAGCAGCACTTTGG + Intronic
1083553411 11:63607689-63607711 CTGCAATCATAGAAGCTGGTGGG + Intronic
1085597948 11:77827281-77827303 CTGTCCTCACAGAATAAGTTGGG - Intronic
1086152763 11:83630610-83630632 CTGTGCTGACAGAAGCAGATTGG + Intronic
1086524188 11:87705284-87705306 CTATAATAACAAAAGCAGCTTGG - Intergenic
1086805259 11:91233473-91233495 ATACAATCACATAAGCAGTTAGG + Intergenic
1087393170 11:97565195-97565217 CTATAAGCCCAGCAGCAGTTTGG - Intergenic
1088094609 11:106084407-106084429 CTGTAATAAAAGAATTAGTTAGG + Intronic
1088188726 11:107203768-107203790 CAATAAGCACAGTAGCAGTTTGG - Intergenic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1090700822 11:129294079-129294101 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1090801513 11:130175639-130175661 CTGTAATCCCACCAGCATTTTGG - Intronic
1091864387 12:3818810-3818832 ATGTAATCACAGAAGCTGGAGGG - Intronic
1092110836 12:5963414-5963436 CTGAAATTAGAGAAGCAGTAAGG + Intronic
1092611930 12:10181764-10181786 CTGTAATCCCAACAGCACTTTGG + Intronic
1093015936 12:14154750-14154772 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1094202717 12:27809762-27809784 CTGTAATCCCAGCACCATTTTGG - Intergenic
1096644918 12:53027390-53027412 CTGTAATCCCAGCAGCACTTTGG - Intronic
1096925482 12:55139857-55139879 CTGTCCTCACAGAATGAGTTAGG - Intergenic
1097612122 12:61836624-61836646 CTGCTTTCAAAGAAGCAGTTTGG - Intronic
1097769367 12:63563764-63563786 CTGACCTCACAGAACCAGTTGGG + Intronic
1098215559 12:68213381-68213403 CTGGACTCACAGAATGAGTTTGG + Intronic
1098323595 12:69277471-69277493 CTGTAATCCCAGCAGCACTCTGG + Intergenic
1098776907 12:74631945-74631967 CTGAACTCACACAATCAGTTAGG + Intergenic
1099063469 12:77943013-77943035 CTGTAATCCCAGAATCAAATTGG - Intronic
1099141863 12:78987818-78987840 CTGTCCTCACAGAATGAGTTAGG - Intronic
1103315834 12:120054333-120054355 CTGTAATCCCAGCACCAATTTGG - Intronic
1103370087 12:120412720-120412742 CTGTGATCCCAGCAGCACTTTGG + Intergenic
1103522554 12:121546079-121546101 CAGTAATCACAGAAATAGATGGG - Intronic
1103807333 12:123583747-123583769 CTGTAATTCCAGCAGCACTTTGG + Intergenic
1103841385 12:123868075-123868097 CTGTTGACACAGAAGGAGTTTGG + Exonic
1104698326 12:130881555-130881577 CTGTATTCCCAGCAGCACTTTGG + Intergenic
1106284268 13:28305583-28305605 CTGTATTTACAGAAACAGGTGGG - Intronic
1108031824 13:46239624-46239646 CTGCCATCACTGAATCAGTTAGG - Intronic
1110858310 13:80320869-80320891 CTGTAATCTCAGCAGCAGTTTGG - Intergenic
1112904026 13:104395185-104395207 CTTCATTCACTGAAGCAGTTGGG - Intergenic
1113338323 13:109397977-109397999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1113580686 13:111426501-111426523 CTGAAGTCACAGAGGCAGTGAGG - Intergenic
1113729377 13:112628871-112628893 GTGTAATTATAGAAGCTGTTGGG - Intergenic
1114081835 14:19207708-19207730 CTGTAATCCCAGCACCATTTGGG + Intergenic
1114949443 14:27730361-27730383 ATGTAATCACAGCAGCAGCTGGG + Intergenic
1115073467 14:29356701-29356723 CTGTAATTGCACAAGCAATTAGG - Intergenic
1115232495 14:31176673-31176695 CTGTAATCCCAGCAGCACTTTGG + Intronic
1116192904 14:41682944-41682966 CTGGCCTCACAGAAGGAGTTTGG - Intronic
1116854017 14:49936240-49936262 CTATAATCCCAGCAGCACTTTGG + Intergenic
1117848012 14:59934259-59934281 CTGTAATCACGGATTCATTTTGG - Intronic
1118203764 14:63702447-63702469 CTGTAATCCCAGCAGCACTTTGG + Intronic
1118613727 14:67561288-67561310 CTGTAGTCCCAGCAGCACTTTGG + Intronic
1118635062 14:67741115-67741137 TTGGAATAAAAGAAGCAGTTGGG - Intronic
1119205333 14:72789791-72789813 CTGTAATCCCAGCAGCACTTTGG - Intronic
1119517696 14:75261308-75261330 CTGTAATCCCAGCAGCACTTTGG - Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1119922152 14:78456433-78456455 CTTTAATGACATAAGCATTTTGG + Intronic
1120550506 14:85865951-85865973 CTGTAATAACAGAATCACTGGGG + Intergenic
1122752229 14:103945452-103945474 CTGTAATCAGAGAATTATTTGGG - Intronic
1123124291 14:105934576-105934598 CTGGACTCACAGAATGAGTTGGG - Intergenic
1123780737 15:23625148-23625170 CTGGCATCACAGAATGAGTTAGG + Intronic
1125118439 15:36123071-36123093 ATGTAGACACAGAATCAGTTTGG - Intergenic
1125266891 15:37891977-37891999 CTGTTATCAAAGAAGCCCTTTGG + Intergenic
1125558640 15:40608483-40608505 CTATAATCCCAGCAGCACTTTGG + Intronic
1126596044 15:50385144-50385166 CTGTAATCCCAACAGCACTTTGG + Intergenic
1127097203 15:55524416-55524438 CTGTGATCCCAGCAGCACTTTGG - Intergenic
1127927237 15:63558612-63558634 CTGTAATCCCACCAGCACTTTGG + Intronic
1128139915 15:65292044-65292066 CTGTAACCCCAGCAGCACTTTGG - Intronic
1129586736 15:76875381-76875403 CTGTAATCCCAGAAAAACTTTGG + Intronic
1131181972 15:90246526-90246548 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1132877196 16:2145234-2145256 CTGTAATCCCAGCAGCACTTTGG - Intronic
1133565744 16:6991795-6991817 CTGTAATCCTAGCAGCACTTTGG - Intronic
1135058099 16:19247487-19247509 CTGTAATCCCAGCAGCACCTTGG - Intronic
1135746692 16:25023055-25023077 CTGTAATCCCAGCACCACTTCGG + Intergenic
1135766980 16:25186234-25186256 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1136303143 16:29350175-29350197 CTGTGCTTACAGAAACAGTTTGG + Intergenic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136571453 16:31099811-31099833 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1137224151 16:46486253-46486275 CTGTATTCATAGAATGAGTTAGG - Intergenic
1137263104 16:46846910-46846932 CTGTAATCCCAGAGGCCGTGGGG - Intergenic
1138208574 16:55143692-55143714 GTGTTATCACAGAAGAAGGTAGG + Intergenic
1138666037 16:58569380-58569402 CTATAATCCCAGCAGCACTTTGG - Intronic
1139699205 16:68697062-68697084 CTGTAATCCCACCAGCACTTTGG + Intronic
1142180475 16:88666861-88666883 CTGTAAGCCCAGCAGCACTTTGG + Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142797449 17:2319652-2319674 CGGTAGACACAGAAGCAGTTGGG - Intronic
1144065386 17:11619948-11619970 CTGTAATCCCACTAGCACTTTGG + Intronic
1145232833 17:21187193-21187215 CTGTAATCCCACCAGCACTTTGG + Intronic
1145278502 17:21452098-21452120 CTGTATTCGCAGCAGCACTTTGG - Intergenic
1145283226 17:21483682-21483704 TTGTACTCACAGAAGCAGAGAGG + Intergenic
1145399349 17:22518382-22518404 CTGTATTCCCAGCAGCACTTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147833055 17:43310622-43310644 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1147932701 17:43992812-43992834 ATGTGACCACAGAAGCAGATTGG + Intronic
1148995753 17:51708072-51708094 TTGTAATCACTGAAGCAGCAAGG - Intronic
1149171895 17:53822173-53822195 GTGTAATTACTGAAGGAGTTTGG + Intergenic
1149676209 17:58464891-58464913 CTGTAATCCCAGCACCATTTTGG - Intronic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1150787874 17:68177280-68177302 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1151619664 17:75238110-75238132 AGGTTATCACAGCAGCAGTTTGG + Exonic
1151798642 17:76364010-76364032 CTGTAATCCCTGCAGCATTTTGG - Intronic
1152796877 17:82312329-82312351 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1154265866 18:12878407-12878429 CTGTAATCCCAGCAGCACTTTGG + Intronic
1154319071 18:13330217-13330239 CTGTAATCCCAGCAGCACTTTGG - Intronic
1158204805 18:54980764-54980786 CTGTAATTCCAGCAGCACTTTGG - Intergenic
1158216114 18:55102397-55102419 CTGTCCTCCCAGAAGCATTTGGG - Intergenic
1158730782 18:60020223-60020245 CTGTGCTAACAGCAGCAGTTAGG - Intergenic
1158886426 18:61831289-61831311 CTGTGATTACAGAATCAGCTCGG + Intronic
1159864525 18:73688507-73688529 ATGGAATCACAGAAACAGTCTGG + Intergenic
1161125181 19:2551978-2552000 CTGTGAACACACAAGCAGTCAGG - Intronic
1161164215 19:2777289-2777311 CTGTGATCCCAGCAGCACTTCGG + Intronic
1161537234 19:4827496-4827518 CTGTAATCCCAGCAGCACTTTGG + Intronic
1161931810 19:7345587-7345609 CTGTAAGCTCAGAAGAAGTCAGG - Intergenic
1162382772 19:10341247-10341269 CTGTAATCCTAGCAGCACTTTGG + Intergenic
1163562636 19:18029311-18029333 CTATAATCCCAGCAGCACTTTGG + Intergenic
1164486646 19:28662219-28662241 CTGGATTCATAGAAGTAGTTAGG - Intergenic
1164490501 19:28708106-28708128 TTTTAATCTGAGAAGCAGTTTGG - Intergenic
1165172168 19:33901462-33901484 CTATAATCACAGAATCTGTTAGG + Intergenic
1165617257 19:37212832-37212854 CTGGCCTCACAGAATCAGTTTGG + Intronic
1165834640 19:38746677-38746699 CTGTAATCCCAGCAGCACTTTGG + Intronic
1166114510 19:40645279-40645301 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1167736867 19:51300043-51300065 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1168396042 19:56049566-56049588 CTGTAATCCCAGCAGCACTTTGG - Intronic
925699622 2:6622349-6622371 CTCTAATCACAGCATCAGCTGGG + Intergenic
926902915 2:17775876-17775898 CTGTAATCCCAGCAGCATTTTGG + Intronic
927431390 2:23029268-23029290 CTGTAATCCCAGCAGCACTTTGG - Intergenic
928100858 2:28436743-28436765 CTGGAATCACAGGAGCAGGAAGG + Intergenic
929258073 2:39835153-39835175 CTGGAATCATAGAATGAGTTAGG + Intergenic
929517229 2:42614850-42614872 CTGTATTCCCAGAAGTATTTGGG + Intronic
929626547 2:43414741-43414763 TTGTTATCAGAGAAGCAGTGAGG - Intronic
931199372 2:60082435-60082457 CTTAAAGCACAGAAGCTGTTTGG - Intergenic
931403471 2:61953268-61953290 CTGTAATCCCAGCAGCACGTTGG - Intronic
931414171 2:62065050-62065072 CTGTAATCCCACAAGTAGCTGGG - Intronic
931710030 2:64980980-64981002 CCGTAATCCCAGCAGCACTTTGG + Intergenic
932131182 2:69188676-69188698 CTAGCTTCACAGAAGCAGTTGGG + Intronic
935338180 2:102036024-102036046 CAGTGACCACAGCAGCAGTTCGG + Intergenic
936590810 2:113802096-113802118 ATCTACTCACAGAGGCAGTTTGG - Intergenic
938031989 2:128002864-128002886 TTGTAATCCCAGCAGCACTTTGG + Intronic
939911709 2:147991304-147991326 CTGTAATCCCAGCAGCACTTTGG - Intronic
940379273 2:152996012-152996034 CTGTCCTCATAGAAGAAGTTTGG - Intergenic
941944442 2:171079053-171079075 GTGGAATCACTGAAGCAGCTGGG + Intronic
943142516 2:184000357-184000379 CTGTAATTACACATCCAGTTAGG + Intergenic
944470937 2:200053652-200053674 CTGTACTAACAGAATTAGTTGGG - Intergenic
947514464 2:230789975-230789997 CTGTAATCCCAGCACAAGTTGGG + Intronic
1169246435 20:4028640-4028662 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1170306607 20:14945336-14945358 CTGAAATCCCAGCAGCACTTTGG - Intronic
1171089147 20:22267718-22267740 CTGTTTTCAGAGGAGCAGTTTGG - Intergenic
1173018030 20:39244481-39244503 CTGGAAGCACAGAAGGAGTCAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175198818 20:57264769-57264791 CTGTAATCCCAGCACCACTTTGG + Intronic
1175791336 20:61741749-61741771 CTGTAATCCCAACAGCACTTTGG - Intronic
1176711989 21:10158417-10158439 CTGTAATCCCAGCACCACTTGGG - Intergenic
1177081532 21:16644536-16644558 CTGTAAACAAGGAAGCAGTCAGG + Intergenic
1178109292 21:29354459-29354481 CTGTAGTCAGACAAGAAGTTAGG + Intronic
1178689752 21:34741132-34741154 CAGTAATCACAGAAGGAAATTGG - Intergenic
1180498940 22:15914962-15914984 CTGTAATCCCAGCACCATTTGGG - Intergenic
1180646924 22:17347023-17347045 CTGTAATCAAACCAGCACTTTGG - Intergenic
1180805212 22:18658026-18658048 CTGTAATCACAGAGTAATTTGGG + Intergenic
1181349751 22:22246520-22246542 CTGTATTTACAGAAACAGATGGG + Intergenic
1181557469 22:23679658-23679680 CTGTAATCTCAGCAGCACTTTGG + Intergenic
1182497842 22:30723044-30723066 CTGTAATCCCAGCAACACTTTGG - Intronic
1183372959 22:37445532-37445554 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1183687845 22:39372058-39372080 CTATAATCACAGCATCAGGTAGG + Intronic
1184001708 22:41679294-41679316 CTGTAATCCCAGCAGCACTTTGG + Intronic
1184488964 22:44798368-44798390 CTGTAATCCCAGCAGCATTTTGG - Intronic
1184655225 22:45937747-45937769 CTATAATCCCAGCAGCACTTTGG + Intronic
950233798 3:11300185-11300207 GTGTAATCCCAGCAGCACTTTGG - Intronic
950395608 3:12731675-12731697 CTGTAATCCCAGCAGCACTTTGG - Intergenic
950991845 3:17448037-17448059 CTGTAGTCTCAGTAGCACTTAGG + Intronic
951005265 3:17608718-17608740 TTGTAATTACAGAAGCAATTTGG - Intronic
951994426 3:28711612-28711634 CTCTAATTATAGAAGCAGATTGG + Intergenic
952014408 3:28939828-28939850 CTGCAATCCCAGCAGCACTTTGG - Intergenic
952907231 3:38149016-38149038 CTATAATCCCAGCAGCACTTTGG - Intergenic
953158767 3:40398959-40398981 CTGTAATACCAGCAGCATTTTGG + Intronic
953593019 3:44278380-44278402 CTGGCATCACAGAATGAGTTAGG + Intronic
954893857 3:53958546-53958568 CTGTAATCACAGCACTTGTTGGG + Intergenic
955228661 3:57080350-57080372 CTGTAGTGACAGCAGCAGCTGGG + Intergenic
955327166 3:58017830-58017852 CTATAAGCAAAGAAGCAGTTTGG + Intronic
955538172 3:59947017-59947039 CTGGCCTCACAGAAGGAGTTAGG + Intronic
955729006 3:61964213-61964235 CTGTAATCACTAAAGTGGTTTGG + Intronic
956791003 3:72680015-72680037 ATGTAACCACAGAAGCTGTGTGG + Intergenic
956976038 3:74580977-74580999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
957367709 3:79248075-79248097 CAGTTATTAGAGAAGCAGTTGGG + Intronic
957970001 3:87371165-87371187 TTCTAATCAGAGAAACAGTTCGG - Intergenic
958132570 3:89447541-89447563 ATTTAATCACAGATGCACTTGGG - Intronic
959545271 3:107588501-107588523 TTGCACTCACAGAAGCAATTTGG + Intronic
960275640 3:115726409-115726431 CTGTAATCCTAGCAGCACTTTGG - Intergenic
961420637 3:126800421-126800443 GAAGAATCACAGAAGCAGTTGGG + Intronic
961932763 3:130551174-130551196 CTGGCATCACAGAATGAGTTAGG + Intergenic
962088444 3:132217320-132217342 CTGTAATTACTGGAGCAGCTTGG + Intronic
962521672 3:136202830-136202852 CTGTCATCCCAGCAGCACTTTGG - Intergenic
963472162 3:145753825-145753847 TTGTATTCACAGAAGCTGTCAGG - Intergenic
965593302 3:170382664-170382686 CTGTAATCCTAGCAGCACTTTGG - Intronic
966180954 3:177188286-177188308 CTGTAATCCCACCAGCACTTTGG + Intronic
966518180 3:180843432-180843454 CTGTAATCCCAGCAGCACTTTGG - Intronic
966707110 3:182928231-182928253 CTGTCTTCACAGAATGAGTTTGG - Intergenic
966811168 3:183846231-183846253 CTGTAATCCCAGCAGTACTTTGG + Intronic
967897314 3:194408276-194408298 CTGTAATCCCACCAGCACTTTGG - Intronic
968114492 3:196079349-196079371 CTGTAATCCCAGCAACACTTTGG + Intronic
969142511 4:5091105-5091127 CTGGCATCACAGAATAAGTTAGG - Intronic
969928252 4:10605567-10605589 CTGTAATCCCAGCAGCACTTTGG + Intronic
970613385 4:17745823-17745845 CTAAAATCACAAAAGCAGGTAGG - Intronic
971060882 4:22967890-22967912 CTTTAATCACAGCAGAAGTGAGG + Intergenic
971176085 4:24284020-24284042 CTGTAATCCCAGCAGCACTCTGG + Intergenic
972125617 4:35761168-35761190 CTGTAATGACAGTAGCAGAGGGG - Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
972284122 4:37631817-37631839 CTGCAATCCCAGCAGCACTTTGG + Intronic
972576661 4:40358158-40358180 CTATAATCCCAGCAGCACTTTGG + Intergenic
974006043 4:56558226-56558248 CTGTAATCCCAACAACAGTTTGG - Intronic
974662483 4:64910590-64910612 CTGGAATCACAGAATAAGTTAGG + Intergenic
974711784 4:65606938-65606960 CTGTATTTAAAGAGGCAGTTAGG - Intronic
975425774 4:74225594-74225616 CTGTCATCCCAAAAGCTGTTTGG - Intronic
976025611 4:80684523-80684545 CTGTAATCCCAGCAGCACTTTGG - Intronic
976203872 4:82606335-82606357 CTGAAATGTCAGAGGCAGTTAGG + Intergenic
979173627 4:117634424-117634446 CTTTAATCACATTAGCAATTTGG + Intergenic
980837718 4:138217376-138217398 TTGTAATCAGAGAAACATTTTGG + Intronic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
981207619 4:142062473-142062495 CTGTAATCCCAGCAGCACTTTGG + Intronic
981634079 4:146855034-146855056 CTGTAATCCCAGCAGCACTTTGG + Intronic
981634099 4:146855170-146855192 CTATAATCCCAGCAGCACTTTGG + Intronic
983518011 4:168677636-168677658 CTGGAATCATAAAAGCATTTAGG - Intronic
983772122 4:171563826-171563848 CTGTAATCTCATCAGCACTTTGG + Intergenic
983808577 4:172027151-172027173 CTATAATCACAGAAATAATTTGG - Intronic
986166655 5:5278420-5278442 CTCTAATCACATAAGCAGGACGG - Intronic
987611755 5:20213385-20213407 CTGGCCTCACAGAAGGAGTTAGG + Intronic
989597710 5:43172003-43172025 CTGTAATCCCAGCAGCACTTTGG - Intronic
991347149 5:65681712-65681734 CTCTAATCCCAGCAGCACTTTGG + Intronic
991395944 5:66205542-66205564 CTGTATTCATAGAAGCAGTAGGG - Intergenic
992846433 5:80753744-80753766 CTCTCATCACATAGGCAGTTAGG + Intronic
993071527 5:83170471-83170493 CTGAAATCAAAGTATCAGTTGGG + Intronic
993907536 5:93640186-93640208 CTGTAATCCCAGCAGCACTTTGG + Intronic
994598797 5:101874929-101874951 CAGGAATCACAAAAGCAGTCAGG + Intergenic
995808351 5:116079142-116079164 CAGTAAAGACTGAAGCAGTTAGG + Intergenic
995817456 5:116187927-116187949 CTGTAATCACAGAAGCAGTTTGG + Intronic
995838882 5:116424490-116424512 CTGTAATCCCAGCAGCACTTTGG + Intergenic
996897906 5:128507076-128507098 TTGGCCTCACAGAAGCAGTTGGG + Intronic
997518111 5:134505134-134505156 CTGAAATCCCAGCAGCACTTTGG + Intergenic
997837272 5:137205584-137205606 CTGCAATCACAGCAGCAGCTGGG - Intronic
1000597446 5:163232213-163232235 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG + Intergenic
1001948542 5:175799790-175799812 CTTTAATCCCAGCAGCATTTAGG - Intronic
1003546268 6:7061579-7061601 CTGTAATCCAAGCAGCACTTTGG - Intergenic
1003617430 6:7668357-7668379 CTGAAATCACAGAAGGTGTTTGG + Intergenic
1003823726 6:9928882-9928904 CTGGACTCACAGAATGAGTTAGG - Intronic
1004833870 6:19508462-19508484 CTGTCCTCACAGAATGAGTTAGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005565009 6:27082585-27082607 CTGAAATTACAGATTCAGTTCGG + Intergenic
1008617717 6:53242260-53242282 CTGTAATCCCAGAAGCAGAAGGG - Intergenic
1009526007 6:64747356-64747378 CTGTAATCCCAGAATCTTTTTGG + Intronic
1009581981 6:65548318-65548340 CTGTATTCACTGAATCAATTAGG + Intronic
1010051575 6:71510555-71510577 CTGTCATTAAAGTAGCAGTTTGG - Intergenic
1010352852 6:74896149-74896171 CTGACGTCACAGAAGGAGTTTGG + Intergenic
1011473575 6:87731451-87731473 CTGTAATCCCAGCAGTAGTTTGG - Intergenic
1011893587 6:92196781-92196803 CTGAAATCACAGAACCACTATGG - Intergenic
1011911304 6:92443700-92443722 CTGTAACTATAGAACCAGTTTGG + Intergenic
1013531269 6:111020907-111020929 CTGTAATCCCAGCAGCCCTTTGG + Intronic
1014265377 6:119270905-119270927 CAATATTCACAGAAACAGTTGGG - Intronic
1015933585 6:138386180-138386202 CTGTAATACCAGCAGCACTTTGG - Intergenic
1016601593 6:145867712-145867734 CTATAACCACAGAGGTAGTTTGG + Intronic
1017799092 6:157876189-157876211 CTGTAATCCCACCAGCACTTTGG + Intronic
1017888692 6:158621817-158621839 CTGTAGCCCCTGAAGCAGTTAGG - Intronic
1021294930 7:18893069-18893091 CTGTAATGACAAAAGCACTTAGG - Intronic
1021528708 7:21618669-21618691 GTTAAATCACAGAAGCAGCTGGG + Intronic
1021698759 7:23298035-23298057 CTGAACTCACAGAAACATTTTGG + Intergenic
1022367539 7:29739016-29739038 CTGACCTCACAGAACCAGTTGGG - Intergenic
1022771107 7:33473580-33473602 CTGTAATCCCAGCAGCACTTTGG - Intronic
1022928646 7:35084853-35084875 CTGACCTCACAGAACCAGTTGGG + Intergenic
1023200070 7:37687415-37687437 CTCTCATCTCAGAAGCTGTTAGG + Intronic
1024452760 7:49566703-49566725 CTGGATTCACAGAATGAGTTAGG - Intergenic
1026317494 7:69239836-69239858 CTGTAATCCCAGCAGGCGTTTGG - Intergenic
1026573273 7:71550639-71550661 CTGTAATCCCACCAGCACTTTGG - Intronic
1026825774 7:73580437-73580459 CTGTAATCCCCCAAGCACTTTGG - Intergenic
1027858442 7:83543410-83543432 CTGGAATCAGAGAAGTATTTTGG - Intronic
1028849151 7:95516872-95516894 TTGAAGTCACAGAAGCAGATGGG - Intronic
1029256826 7:99274932-99274954 CTATAATCCCAGCAGCACTTTGG - Intergenic
1029365650 7:100114457-100114479 CTGTAATCCCACCAGCACTTTGG + Intronic
1029824758 7:103178531-103178553 CTGACCTCACAGAACCAGTTGGG + Intergenic
1030771430 7:113480012-113480034 CTGTACACACAGAAAAAGTTAGG + Intergenic
1031397234 7:121287708-121287730 TTGTAATCGCAGAAGAATTTGGG - Intronic
1031892588 7:127311938-127311960 CTGGCCTCACAGAAGGAGTTTGG - Intergenic
1032672154 7:134094550-134094572 CTGGATTCACAGAATGAGTTAGG - Intergenic
1032793824 7:135261701-135261723 CTGTGGGCACAGAAGCAGTAGGG + Intergenic
1033239737 7:139667865-139667887 CTGTAATCCCAGCAGCACTTTGG + Intronic
1033281942 7:140012321-140012343 CTATAGTCACAAAAGTAGTTGGG + Intronic
1033636705 7:143218623-143218645 TTGTGTTCACAGAAGGAGTTTGG - Intergenic
1034257351 7:149731924-149731946 GTTTTATCACAGAAGCAGTTGGG + Intronic
1035627685 8:1084567-1084589 CTGAAAGCACAGAAGCAGTGAGG - Intergenic
1039636882 8:39177319-39177341 CTGTAATCACTCAAGCACTTTGG - Intronic
1039877763 8:41602213-41602235 CTGTAATCCCAGCACCACTTTGG - Intronic
1040077800 8:43257635-43257657 CTGAAATCGCAGCAGCACTTTGG - Intergenic
1040298428 8:46175394-46175416 CTGTCATAAGAGAAGCATTTTGG - Intergenic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1041812704 8:61929255-61929277 CTGTAATCTGAGAAACTGTTTGG + Intergenic
1041938930 8:63365780-63365802 CAGTAATCCCAGGAGCAATTTGG - Intergenic
1042355792 8:67826016-67826038 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1042580801 8:70277157-70277179 GCGTAATCACTGAAGCAATTAGG - Intronic
1044336575 8:90990764-90990786 CTTTAATCCCAGCAGCACTTTGG + Intergenic
1044726282 8:95196640-95196662 CTGTAATTAGGCAAGCAGTTGGG + Intergenic
1045617292 8:103932802-103932824 CTGTAATCACAGGATCACTTGGG + Intronic
1048932098 8:139323394-139323416 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1049366887 8:142243550-142243572 CTGAACTCACAGAAGCAGAGAGG + Intronic
1050061706 9:1716317-1716339 CTGAAAGAACAGAAGCAATTAGG + Intergenic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051257551 9:15230722-15230744 CTGTAATCCCAGCAGGACTTTGG + Intronic
1051693101 9:19738187-19738209 CTGTAGTGACAGAAGCACTAAGG - Intronic
1051866095 9:21684708-21684730 CTGGAATCACAGAAGCCATCAGG - Intergenic
1051891776 9:21949674-21949696 CTGGCCTCACAGAAGGAGTTGGG - Intronic
1053648984 9:40144111-40144133 CTGTAATCCCAGCACCACTTGGG - Intergenic
1053756759 9:41319750-41319772 CTGTAATCCCAGCACCACTTGGG + Intergenic
1054329961 9:63742047-63742069 CTGTAATCCCAGCACCATTTGGG - Intergenic
1054535599 9:66232062-66232084 CTGTAATCCCAGCACCACTTGGG + Intergenic
1055939016 9:81631740-81631762 ATGAAATCACAGAAGAAATTTGG - Intronic
1055956961 9:81783016-81783038 CTATAATCCCAGAAGGATTTTGG - Intergenic
1056630130 9:88286657-88286679 CTGTAATCACAGCAGGAGACGGG + Intergenic
1057736826 9:97670173-97670195 CTATAATCCCAGCAGCACTTTGG - Intronic
1057915413 9:99051693-99051715 CCGTAAGCACAGAAGGATTTTGG + Intronic
1058132639 9:101270056-101270078 CTGTACTTACAATAGCAGTTGGG - Exonic
1058835701 9:108856999-108857021 CTGTAATCCCACCAGCACTTTGG + Intergenic
1059451467 9:114373616-114373638 CTGTAATCCCAGCAGCACTTTGG + Intronic
1059532814 9:115052740-115052762 CTGTAATGACAAAGGCAGTGAGG + Intronic
1059737755 9:117119339-117119361 CTGCAAACTCAGAAGCAATTGGG - Intronic
1059976294 9:119721274-119721296 CTGTAAGAAGAGAAGCATTTAGG + Intergenic
1060448303 9:123712657-123712679 CTGTTATAACAGAAGCAGGGAGG - Intronic
1061530324 9:131206700-131206722 CTGTAATCTCATCAGCACTTTGG - Intronic
1202796743 9_KI270719v1_random:127407-127429 CTGTAATCCCAGCACCACTTGGG - Intergenic
1185703636 X:2250232-2250254 CTGTAATCCCAGCAGAACTTTGG + Intronic
1185764270 X:2712175-2712197 CTGAACTCACAGAAGCAGAGTGG + Intronic
1187624553 X:21095859-21095881 CTGGCATCACAGAATGAGTTTGG - Intergenic
1188254677 X:27947073-27947095 CGGTAATCACAGATGCAATTCGG + Intergenic
1188738421 X:33746662-33746684 CTGTAATCACGCCAGCACTTTGG - Intergenic
1189339382 X:40193054-40193076 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1189813162 X:44799329-44799351 CTGTAATCCCAGCAGCACTCTGG + Intergenic
1189873860 X:45413932-45413954 CTGTTCTCATAGAATCAGTTTGG + Intergenic
1189990176 X:46586626-46586648 CTTTACTCACAAAAGCAATTAGG + Intronic
1190115632 X:47624678-47624700 CTGTAATCCCAGCAACACTTTGG - Intronic
1190969776 X:55337252-55337274 ATGTATCCACAGAAGTAGTTTGG - Intergenic
1191664131 X:63680955-63680977 TAGTAACCACAGCAGCAGTTGGG - Intronic
1192134625 X:68585617-68585639 CTGTAATCGCAGCAGCACTTTGG - Intergenic
1192484391 X:71512555-71512577 CTGTAATCCCACCAGCATTTTGG + Intronic
1193390716 X:80925301-80925323 CTGGCTTCACAGAAACAGTTTGG + Intergenic
1193479258 X:82007237-82007259 CTGGACTCACAGAATGAGTTGGG + Intergenic
1195628079 X:107024299-107024321 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1196806301 X:119589943-119589965 AAGTAATTGCAGAAGCAGTTGGG - Exonic
1198490629 X:137137100-137137122 CTGACATCACAGAATGAGTTAGG - Intergenic
1199578981 X:149342738-149342760 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1201236047 Y:11912845-11912867 CTATACTCACAGAAGCACTCAGG - Intergenic
1201365380 Y:13200100-13200122 ACATAATCATAGAAGCAGTTGGG - Intergenic
1201724844 Y:17140371-17140393 TTGTAATGTCAGAAGCAGATTGG + Intergenic
1201747568 Y:17395486-17395508 CTGTAATCCTACAAGCACTTTGG - Intergenic
1202038089 Y:20655525-20655547 CTGTAATGGCCTAAGCAGTTTGG - Intergenic
1202073966 Y:21019987-21020009 CAGTAATCTCAGAACCTGTTTGG + Intergenic
1202078666 Y:21061842-21061864 CAGTAATCTCAGAACCTGTTTGG + Intergenic