ID: 995818405

View in Genome Browser
Species Human (GRCh38)
Location 5:116198478-116198500
Sequence CAAACATATCACTCTAATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995818405_995818409 30 Left 995818405 5:116198478-116198500 CCCCTATTAGAGTGATATGTTTG 0: 1
1: 0
2: 1
3: 13
4: 146
Right 995818409 5:116198531-116198553 TCAAGACCCTAGTTAATATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995818405 Original CRISPR CAAACATATCACTCTAATAG GGG (reversed) Intronic
907888429 1:58615417-58615439 CAAATATACCACTCTGACAGGGG - Intergenic
907907115 1:58792784-58792806 GAAAAATATCCATCTAATAGTGG - Intergenic
909069395 1:70976382-70976404 TAAACATACCACTCTGGTAGGGG + Intronic
909510367 1:76446284-76446306 CAAATATACCACTCTAGTAATGG - Intronic
911318730 1:96386568-96386590 CAAACATACCACTCTCATAGGGG + Intergenic
914919196 1:151836313-151836335 CAATCAAGTCACTCTAAAAGGGG - Intergenic
914946119 1:152067999-152068021 CCAACATATCACTCAAATCAGGG - Intergenic
917585139 1:176418220-176418242 CAAATGTACCACTCTAATGGAGG - Intergenic
918878843 1:190086729-190086751 AAAACATATTACTCTTAAAGTGG - Intergenic
919560221 1:199109228-199109250 CCAACAAATCCCTCTAATTGGGG - Intergenic
921027321 1:211298423-211298445 CAAAAATATAAATCTAGTAGGGG + Intronic
921391430 1:214618270-214618292 AAACCATATCACTGTCATAGTGG + Intronic
921987004 1:221322961-221322983 TAAACATGTCACTCTGATGGGGG + Intergenic
923940756 1:238823114-238823136 CAAATGTATCACTCTAGTGGGGG + Intergenic
924541950 1:244989445-244989467 CAAACATCAAATTCTAATAGAGG - Intronic
1063908367 10:10803744-10803766 CAAACAGTGCATTCTAATAGGGG - Intergenic
1064718330 10:18201070-18201092 CAAACATATAACTCTCCTAGAGG - Intronic
1067927509 10:50525204-50525226 CCAACATGTAACTCCAATAGAGG - Intronic
1071689186 10:87797523-87797545 AAAACAGAACACTCTAAAAGGGG - Intronic
1072170954 10:92861281-92861303 CAAGGATATCACTCCAAGAGAGG - Intronic
1074115224 10:110452506-110452528 CAAACATAGCATTCCAATAATGG + Intergenic
1074804919 10:117039529-117039551 TAAATGTATCACTCTGATAGGGG + Intronic
1075191337 10:120311911-120311933 CCAACATCTCAATCTCATAGTGG + Intergenic
1078407453 11:11082745-11082767 CAAGCAAATCACTCTAGAAGGGG + Intergenic
1080992057 11:37548423-37548445 CCAACATAACACACTAATACAGG + Intergenic
1081459538 11:43259203-43259225 CAAACGTACCACTCTAGTTGGGG + Intergenic
1087289587 11:96305393-96305415 CAAACATACCACTCTGGTGGAGG + Intronic
1088423352 11:109673111-109673133 CAAACGTACCACTCTGATATGGG - Intergenic
1091248124 11:134117437-134117459 CAAATATTTCTCTCTAATAAGGG - Intronic
1092063262 12:5567784-5567806 CAAGCATATCCATCTAATTGAGG + Intronic
1092512563 12:9172116-9172138 GAAACATATCATACTAACAGTGG + Intronic
1095142137 12:38677156-38677178 CAAATACATCAAACTAATAGAGG + Intronic
1095527851 12:43149512-43149534 CAAACATATAACTACATTAGAGG + Intergenic
1097319682 12:58211355-58211377 CAAACACATCCCTCTCATGGCGG + Intergenic
1097848293 12:64388236-64388258 CAAACAAAACACTTTAAAAGGGG - Intronic
1098584674 12:72141897-72141919 CCAATTTATCACTCTAAAAGAGG - Intronic
1099565320 12:84235865-84235887 CAAAAATATCTCACTCATAGAGG - Intergenic
1101724932 12:107381180-107381202 CAGACCTATCTTTCTAATAGAGG - Intronic
1104104858 12:125649744-125649766 CAAACAAAGCACTCTCATAAAGG + Intronic
1105643739 13:22294145-22294167 CAAATGTACCACTCTAATGGTGG - Intergenic
1107446827 13:40476895-40476917 CAGAAATATCCCTCTAACAGTGG - Intergenic
1110244028 13:73301395-73301417 CTAACAAATGACTCTATTAGTGG + Intergenic
1112070776 13:95847256-95847278 CAAACATATCACTTTGGTGGGGG - Intronic
1113055039 13:106259103-106259125 CAAACATGTTTCTCTAAAAGTGG - Intergenic
1113134933 13:107078930-107078952 CAAAAATACCACTTTGATAGAGG + Intergenic
1115422471 14:33212375-33212397 CAAGAAGATTACTCTAATAGGGG + Intronic
1117573784 14:57077071-57077093 TAAACATAACACTCTAAGAGTGG + Intergenic
1120332478 14:83111599-83111621 CAAATATGTCACTCCAATGGGGG + Intergenic
1120349930 14:83342466-83342488 AAAACCTATCACTCAGATAGGGG + Intergenic
1120402808 14:84053807-84053829 CAAACATATGAATTTAAAAGTGG + Intergenic
1120754236 14:88227162-88227184 CAGAAATATCACTCTAAAATAGG + Intronic
1128466197 15:67914622-67914644 GAAATATATCACTCTACTTGAGG - Intergenic
1131337542 15:91563766-91563788 CAAAAATAGCACTTAAATAGAGG + Intergenic
1140174793 16:72646902-72646924 CAAACATACCACTCAAATGCAGG + Intergenic
1141759552 16:86018861-86018883 CAAACATAACACTCCAAAAGTGG - Intergenic
1146563795 17:33894500-33894522 CAACGATATGACTCTCATAGTGG - Intronic
1150975203 17:70078169-70078191 AAAACATAACATTCTAATAGAGG + Intronic
1153315804 18:3720659-3720681 CAAATATAGCAAACTAATAGCGG - Intronic
1155510808 18:26574898-26574920 CAAAGATATCACTATAATTGAGG - Intronic
1156908669 18:42384980-42385002 CAAACCTAACACTCAAATATAGG + Intergenic
1157000512 18:43517866-43517888 GAAACACATTACTCTAATTGAGG - Intergenic
1158534446 18:58295063-58295085 CAAACATACCACTCTGGTGGGGG - Intronic
927044264 2:19261631-19261653 CAAACATATCACTCTGGTGGGGG + Intergenic
927259572 2:21073702-21073724 CAAATATACCACACTAATAGGGG - Intergenic
932285412 2:70527673-70527695 CAAACATATCACACCAATGCAGG + Intronic
933332620 2:80913592-80913614 CATACATATTACCTTAATAGGGG - Intergenic
936620567 2:114092756-114092778 CAAACACACCACTCTAGTGGAGG - Intergenic
939670559 2:145006608-145006630 CCAACATATCACACTGAAAGGGG - Intergenic
942595332 2:177586872-177586894 CAAACATGTTCCTCTACTAGAGG - Intergenic
942919022 2:181348281-181348303 CAAACATACCACTCTGGTGGGGG + Intergenic
944461268 2:199953375-199953397 CAAATATACCACTCTAATGAGGG + Intronic
944842031 2:203633906-203633928 TGAACATATCACTTTAATAAAGG - Intergenic
945123223 2:206480666-206480688 TAAACATATGACTCTTAAAGGGG + Intronic
946901209 2:224373521-224373543 CAAACATATTAGTTTATTAGTGG - Intergenic
947898884 2:233702741-233702763 AACACATATCACTAGAATAGGGG - Intronic
1169651137 20:7868754-7868776 AAAATATATAACTCAAATAGTGG - Intergenic
1171479421 20:25442242-25442264 TAAACATAACAATTTAATAGAGG + Intronic
1174024617 20:47563353-47563375 CAAACTCACCACTCTGATAGGGG + Intronic
1177484458 21:21738919-21738941 CAAATATACCACTCTAGTGGGGG + Intergenic
1182776678 22:32836649-32836671 CAACCACATCACTCACATAGTGG - Intronic
1183777852 22:39979317-39979339 CAAATATATCACTCTGCTGGAGG + Intergenic
952071641 3:29644093-29644115 CAAACATTTGAATCTAATAGAGG + Intronic
955257506 3:57348541-57348563 CAAATATATCACTCTGGTAAGGG + Intronic
955432464 3:58862174-58862196 CAAAAGCATTACTCTAATAGTGG - Intronic
957432108 3:80124095-80124117 CAAATATATCACTCTGATGCAGG + Intergenic
957765298 3:84616967-84616989 CAAAAATATGTCTGTAATAGAGG - Intergenic
960239589 3:115324877-115324899 CCAACACATCACTCTAATGTAGG + Intergenic
960492038 3:118328848-118328870 CATACTTAGCATTCTAATAGTGG + Intergenic
962154942 3:132936367-132936389 GAAACATATCAATGTAATAAAGG + Intergenic
965695865 3:171407467-171407489 AAAACACATCATTTTAATAGTGG - Intronic
970657575 4:18248519-18248541 CACAGATCTCTCTCTAATAGAGG - Intergenic
972526377 4:39916443-39916465 AAAACATATCTATCTAATAATGG + Intronic
972810151 4:42575495-42575517 CAAATATATTATTCAAATAGTGG + Intronic
973185164 4:47318498-47318520 CTTACAAATCTCTCTAATAGTGG - Intronic
973935403 4:55841618-55841640 TAAAGACATCACTCTAATATAGG - Intergenic
974789438 4:66668184-66668206 AAAATATACCACTCTGATAGGGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977428361 4:96899188-96899210 CAAATACATCACTCTGATGGAGG + Intergenic
980606463 4:135097896-135097918 AAAAACTATCAATCTAATAGGGG + Intergenic
981290973 4:143074066-143074088 AAACCATATCAATCTTATAGTGG + Intergenic
982246609 4:153358996-153359018 CAAACATATTACACTAGTATAGG - Intronic
982627848 4:157790099-157790121 TAATCATAAAACTCTAATAGAGG + Intergenic
982962020 4:161851358-161851380 TAAACAGATTATTCTAATAGTGG - Intronic
983960331 4:173745049-173745071 CATACATACCACTCAAATATAGG - Intergenic
987196705 5:15534124-15534146 CAAACATACCACTCTGGTGGGGG - Intronic
987628125 5:20429929-20429951 CAAAAATATCACTATAAGAAGGG - Intronic
989154488 5:38331203-38331225 CAAATGTACCACTCTGATAGGGG - Intronic
993653381 5:90549945-90549967 CAAACATCTCAGTCTTAAAGAGG + Intronic
994359759 5:98837428-98837450 CAAATATATCATTATAACAGAGG + Intergenic
995818405 5:116198478-116198500 CAAACATATCACTCTAATAGGGG - Intronic
996590153 5:125138012-125138034 CAAAGATATGACAGTAATAGAGG - Intergenic
998697999 5:144662857-144662879 CAATCATATTACTATAATATGGG - Intergenic
999210427 5:149883541-149883563 AAAACATATCAGTCTAGTAAAGG + Intronic
1000224770 5:159249904-159249926 CAAACGTACCACTCCAATGGGGG - Intergenic
1000846006 5:166280939-166280961 GAAGCAAATCACTCTAAGAGAGG - Intergenic
1000870669 5:166573293-166573315 AAAACATTTCAAACTAATAGTGG + Intergenic
1008843748 6:55936636-55936658 CAAACATATCATACTTATACAGG + Intergenic
1011151303 6:84276361-84276383 CAAGTATATCACTCTAAAAGAGG + Intergenic
1011712855 6:90072264-90072286 CAAACAGTTCACTCAAGTAGAGG - Intronic
1013531401 6:111022185-111022207 CAAACATAACATTCTAATTGAGG + Intronic
1014669345 6:124281108-124281130 GAAACACATCAGTCTAACAGTGG - Intronic
1015637348 6:135290422-135290444 CAGAAAAGTCACTCTAATAGAGG - Exonic
1016374001 6:143402034-143402056 CAAACAAATCACTCTTCAAGGGG - Intergenic
1019722188 7:2579409-2579431 CAACCAGATCACTGTAATGGGGG + Intronic
1023725156 7:43135797-43135819 AAAAGATATAACTCAAATAGGGG - Intronic
1027393656 7:77730351-77730373 CAAATGTACCACTCTGATAGGGG - Intronic
1027982830 7:85249021-85249043 CAAATGTACCACTCTGATAGGGG + Intergenic
1030799555 7:113832811-113832833 CAAATATATCTCTCTAATAAAGG - Intergenic
1032656107 7:133931785-133931807 CAAACACATCACCCTTATGGAGG - Intronic
1032900156 7:136297921-136297943 CAAACATATAAATGTAAAAGTGG - Intergenic
1032957654 7:136990171-136990193 CAAATGTACCACTCTGATAGAGG - Intronic
1034499759 7:151441987-151442009 CAAATGTACCACTCTAATGGGGG - Intergenic
1036983773 8:13502644-13502666 CAAAGATTTCTCTCTATTAGGGG - Intronic
1038842707 8:31200714-31200736 CAAACATACCAATCTGGTAGGGG - Intergenic
1039498913 8:38001639-38001661 AAAACATCTCAACCTAATAGGGG + Intergenic
1039809953 8:41037862-41037884 CAAACTTTTCTCTATAATAGTGG + Intergenic
1041536337 8:58929983-58930005 CAAATACATCAATTTAATAGTGG + Intronic
1042225199 8:66509834-66509856 CAAACATATCCCTCTGGTGGGGG - Intronic
1043625189 8:82248333-82248355 CAAATGAATAACTCTAATAGAGG - Intergenic
1044753865 8:95441621-95441643 AAAACAAATCACCCTAATATAGG - Intergenic
1045139211 8:99261077-99261099 CAAATGTATCACTCTGATAGGGG - Intronic
1047632169 8:126720199-126720221 CACACAAATAACTCTAATAGTGG + Intergenic
1048176716 8:132159352-132159374 CAATCATGTGACTCTAATGGGGG + Intronic
1051080491 9:13288302-13288324 CCAACGTATCACACTTATAGAGG - Intergenic
1051940625 9:22501358-22501380 AAACCATATCACTCTAATTAGGG + Intergenic
1051988832 9:23125890-23125912 CAAACGTACCACTCTGATACAGG - Intergenic
1052607863 9:30728575-30728597 GCAACAAGTCACTCTAATAGAGG - Intergenic
1053519116 9:38759975-38759997 GAAACCTTTAACTCTAATAGTGG + Intergenic
1055322665 9:75097678-75097700 CAAACATAAAAGTCTAATGGGGG + Intronic
1055371168 9:75601255-75601277 CCAACATATGACTCCTATAGTGG + Intergenic
1057463130 9:95284629-95284651 CAAACATATCACTAGCATACTGG + Intronic
1058096680 9:100869408-100869430 CAAAAATATCCCTTTAAAAGAGG + Intergenic
1186242175 X:7580987-7581009 CAAACAACTCAATCTAAAAGTGG + Intergenic
1188377095 X:29444534-29444556 AAAACCTATCACACTAATATAGG + Intronic
1189115282 X:38335937-38335959 CAGACTTAACACTCTAAAAGGGG - Intronic
1192271992 X:69589497-69589519 CTAACATATCATTAGAATAGGGG - Intergenic
1193896730 X:87123376-87123398 CAAATATACCACACTAATACAGG + Intergenic
1196645983 X:118117322-118117344 CACAAATATCACTCTTCTAGTGG + Intronic
1197241177 X:124124888-124124910 CAAACATACCACTCTTGTTGGGG + Intronic
1197971555 X:132120192-132120214 CAAATGTATTACTCTAATAAAGG - Intronic
1198410839 X:136365986-136366008 CAAACATACCACTCTGGTGGGGG - Intronic