ID: 995819514

View in Genome Browser
Species Human (GRCh38)
Location 5:116213275-116213297
Sequence CTCAAACAGATGTGAATACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995819512_995819514 6 Left 995819512 5:116213246-116213268 CCACTAATAGGAGTTGTAAAGAT 0: 1
1: 0
2: 0
3: 5
4: 147
Right 995819514 5:116213275-116213297 CTCAAACAGATGTGAATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995819514 Original CRISPR CTCAAACAGATGTGAATACT AGG Intronic
No off target data available for this crispr