ID: 995820192

View in Genome Browser
Species Human (GRCh38)
Location 5:116221276-116221298
Sequence GATTTTAAGGAGATAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995820192_995820205 14 Left 995820192 5:116221276-116221298 CCCTCTACTATCTCCTTAAAATC 0: 1
1: 1
2: 4
3: 30
4: 292
Right 995820205 5:116221313-116221335 CCTCTGGGAGATGGATTTGAGGG 0: 1
1: 9
2: 42
3: 70
4: 237
995820192_995820197 -1 Left 995820192 5:116221276-116221298 CCCTCTACTATCTCCTTAAAATC 0: 1
1: 1
2: 4
3: 30
4: 292
Right 995820197 5:116221298-116221320 CCCCAGCCCAGAACTCCTCTGGG 0: 1
1: 5
2: 40
3: 80
4: 380
995820192_995820195 -2 Left 995820192 5:116221276-116221298 CCCTCTACTATCTCCTTAAAATC 0: 1
1: 1
2: 4
3: 30
4: 292
Right 995820195 5:116221297-116221319 TCCCCAGCCCAGAACTCCTCTGG 0: 1
1: 8
2: 33
3: 86
4: 316
995820192_995820203 13 Left 995820192 5:116221276-116221298 CCCTCTACTATCTCCTTAAAATC 0: 1
1: 1
2: 4
3: 30
4: 292
Right 995820203 5:116221312-116221334 TCCTCTGGGAGATGGATTTGAGG No data
995820192_995820201 5 Left 995820192 5:116221276-116221298 CCCTCTACTATCTCCTTAAAATC 0: 1
1: 1
2: 4
3: 30
4: 292
Right 995820201 5:116221304-116221326 CCCAGAACTCCTCTGGGAGATGG 0: 1
1: 8
2: 32
3: 88
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995820192 Original CRISPR GATTTTAAGGAGATAGTAGA GGG (reversed) Intronic
901269636 1:7941983-7942005 GAGTATAAGGAGAAAGAAGAGGG + Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902135916 1:14305308-14305330 GAATTTAAGGATATTTTAGAGGG + Intergenic
903927013 1:26837779-26837801 GTTTTCAAGAAGATAGAAGAGGG - Intronic
904663958 1:32105840-32105862 GCTTTTCAGGAGATAGTGGGTGG + Intergenic
905173456 1:36122683-36122705 GAGTTTAAGGAGAAAGGTGACGG - Intronic
905517873 1:38575394-38575416 GATTTTTATGATATTGTAGAAGG + Intergenic
906070884 1:43015610-43015632 GATCTTAAAGATATAGGAGAGGG - Intergenic
907521991 1:55029993-55030015 GGGTTTAAGGAGAAAGGAGAAGG - Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
908359497 1:63354921-63354943 GGTTTTAATGAGAAAGGAGACGG - Intergenic
908741500 1:67333565-67333587 GAATTTAATGACATAGTAAAGGG - Intronic
909555042 1:76944243-76944265 TATTTTAAAGAGAGAATAGATGG + Intronic
909745404 1:79089994-79090016 TATTATAAGCAGATAGTAAATGG + Intergenic
909776563 1:79491337-79491359 GGTTTTAATGAGATAGTAAGGGG + Intergenic
909792867 1:79699133-79699155 GGTTTTAATGAGATAGTAAGGGG + Intergenic
909884132 1:80919385-80919407 GATTTTAAGGATATAGGAGAAGG + Intergenic
910616157 1:89200394-89200416 AATTTTAAGGAGGTAGTGGTTGG - Intergenic
911510503 1:98804023-98804045 GGTTTTAATGAGATAGTAAGGGG + Intergenic
912561113 1:110552158-110552180 GATTTCTAGGAGATAGTAGACGG - Intergenic
913371088 1:118100712-118100734 TATTTAAATGAGATAGCAGAGGG - Intronic
913437228 1:118859677-118859699 GTTTTTAAGCAGAAAGTAAACGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915100145 1:153493335-153493357 GATATTTAGAAAATAGTAGAGGG - Intergenic
915657009 1:157369029-157369051 GTTTTTAAGGATATCGTGGAGGG + Intergenic
915671982 1:157497286-157497308 GTTTTTAAGGATATAGTGGAGGG - Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
919247804 1:195011630-195011652 GATCAATAGGAGATAGTAGATGG + Intergenic
922552316 1:226504890-226504912 CAGTTTAAGGAGATAGAAGTGGG + Intergenic
922877207 1:228949172-228949194 GGTTTTAATGAGATAGTAAGGGG - Intergenic
923449903 1:234106744-234106766 CATTTCAAGGAGAAAGTAAAGGG - Intronic
924686490 1:246296637-246296659 AATTTTATAGAGAAAGTAGAAGG - Intronic
1063755459 10:9002004-9002026 GAAGTTAAGTAGATAGTACAGGG + Intergenic
1064476429 10:15694946-15694968 GAGTTAAAGGAGATCGCAGAAGG + Intronic
1068009604 10:51431523-51431545 GAATTTAAGAAGATAGTTGAAGG + Intronic
1068391118 10:56398031-56398053 AATTTTATGGTGATAGAAGATGG - Intergenic
1071706697 10:88006934-88006956 GCTGTTAGGGAGAGAGTAGATGG + Intergenic
1072228649 10:93394050-93394072 TATTTTAAGCAAATGGTAGAAGG - Intronic
1073394804 10:103208829-103208851 GATTTTAGTGGGATAGTAGTGGG - Intergenic
1073822986 10:107286450-107286472 GATCTTATGGAGATGGTAGCGGG - Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075396210 10:122129503-122129525 CATTTTAAGGAGATAATTAAGGG - Intronic
1078408204 11:11089651-11089673 GATTTTAGCGAGAGAGGAGAGGG + Intergenic
1078849052 11:15147505-15147527 TATTTTAAAGAGCTAGTATAAGG - Intronic
1078933749 11:15934690-15934712 GATTTCCAGGAAAGAGTAGATGG - Intergenic
1078993974 11:16678372-16678394 GATTTTAAAAAGAAATTAGAAGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079477029 11:20841922-20841944 GCTTTTAAGTAAATAGTAGTGGG - Intronic
1080109309 11:28547550-28547572 GATTTTGAAAAGATAATAGAGGG + Intergenic
1080272880 11:30469249-30469271 TATTTTAAGAAAAAAGTAGATGG - Intronic
1081477367 11:43447843-43447865 GATTTTAATTAGATCATAGATGG + Intronic
1083339525 11:61950105-61950127 GATTTTAGGGCCATGGTAGAGGG + Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1086550336 11:88046122-88046144 GGTTTTAATGAGATGGTAAAGGG - Intergenic
1087694393 11:101359653-101359675 GAACTCATGGAGATAGTAGAAGG + Intergenic
1088029647 11:105230994-105231016 GAAATTAAGCAGTTAGTAGAGGG - Intergenic
1090546374 11:127771849-127771871 GATTTTAATGAGATGGTAAAGGG + Intergenic
1090547722 11:127783580-127783602 TATTTTAAGAAAATACTAGATGG + Intergenic
1091163932 11:133453900-133453922 GATATTAATGAGATATTTGAAGG + Intronic
1091292083 11:134446488-134446510 GACTTTAGGGAGATAGCAAAAGG - Intergenic
1091767204 12:3129436-3129458 GACTCTCAGGAGGTAGTAGAAGG - Intronic
1092416066 12:8291360-8291382 GATTTTAATGAGATGGTAAGGGG + Intergenic
1092892676 12:12983543-12983565 AATGTTAATGAGATGGTAGAAGG - Intronic
1095163795 12:38948023-38948045 GAACTCATGGAGATAGTAGAAGG + Intergenic
1099302184 12:80911232-80911254 GATTTTAAGGAGGTTCTAGAGGG + Intronic
1099879156 12:88445597-88445619 AATTTTAGGGAGATATTAAAGGG + Intergenic
1100215190 12:92440562-92440584 AATTTTAATGACATATTAGATGG + Intergenic
1100510256 12:95264222-95264244 GAATTTAAGGAGCTGATAGAAGG + Intronic
1101025659 12:100602826-100602848 GAACTCACGGAGATAGTAGAAGG - Intronic
1101132386 12:101702812-101702834 GATTTCCAGGAGATAGAAGCAGG + Intronic
1101385145 12:104250700-104250722 GATGATAAGGAGATTGAAGAAGG + Intronic
1101804072 12:108048170-108048192 GATTTCAAGGAAATAGAGGAAGG + Intergenic
1105032349 12:132892649-132892671 GGTTTTAAGGGGATAGTAATGGG - Intronic
1105814107 13:24017738-24017760 GATTTAAAGGAGAAAGAAGGAGG - Intronic
1106896380 13:34307280-34307302 GAATTTACAGAGATAGTAGGAGG + Intergenic
1107564665 13:41589842-41589864 GATTTTACGGGGGTAGTAAATGG - Intronic
1108574293 13:51778182-51778204 CATTTTCAGGAGATAATAGCTGG + Intronic
1109570061 13:64176519-64176541 TATTTGAAGGAGAGAGTAGAAGG + Intergenic
1110910858 13:80961044-80961066 GAATTCATGGAGATAGTAGAAGG - Intergenic
1111255956 13:85669142-85669164 GATCTTAATGACATATTAGAAGG + Intergenic
1113157455 13:107339777-107339799 GAGTTAAAGGAGAAAGTAAATGG - Intronic
1113357786 13:109599947-109599969 GATTCTAATGAAATAGTACAGGG + Intergenic
1116480139 14:45387231-45387253 GGTGTTAAGTAGATAGTAGGAGG - Intergenic
1116630262 14:47321825-47321847 GTTATTAAGGAGAGAGAAGATGG - Intronic
1116722196 14:48511833-48511855 TATGTTAAGGAGATAGTAGTAGG - Intergenic
1117174280 14:53131330-53131352 GATTTTAATGGGATAGTAATGGG - Intronic
1117966774 14:61214422-61214444 TAATTTTAGGAGATTGTAGAGGG - Intronic
1118057493 14:62095855-62095877 GCTTTTAAAAAGATGGTAGAGGG + Intronic
1118963279 14:70555854-70555876 GGTTTAACGGAGAAAGTAGATGG - Intergenic
1119560147 14:75583449-75583471 GATTTTAATGGGATAGTAATGGG + Intronic
1119820608 14:77612870-77612892 AGTTTTAATGAGATATTAGAAGG - Intronic
1120560226 14:85982857-85982879 GATTTTTAGTAGATAGTAAATGG - Intergenic
1122341303 14:101030245-101030267 GATTTTAACGAGGTAGGAGGAGG - Intergenic
1122870670 14:104636855-104636877 GATTTAAATGAGATAGCAAAGGG - Intergenic
1126256694 15:46635582-46635604 AATTTTAAAGAGATAGTAGAAGG - Intergenic
1128661590 15:69505161-69505183 GCATTTCAGGAGCTAGTAGAGGG - Intergenic
1129941306 15:79499303-79499325 GATTGTCAGGATATTGTAGAAGG + Intergenic
1130130719 15:81140066-81140088 GATTTGCAGGAGAGAGGAGAGGG - Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131323991 15:91424675-91424697 GATTTTAAGAAGAGAGGAGTGGG - Intergenic
1131681364 15:94727237-94727259 GATTTAAAAGACTTAGTAGAAGG - Intergenic
1134342051 16:13355339-13355361 GATTTTAATGAGATGGTAAGGGG + Intergenic
1135770601 16:25215358-25215380 GGTTTAAATGAGATAATAGAAGG + Intergenic
1135790455 16:25389498-25389520 GATTTTAAGGAGTTTGGAGTAGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1140556824 16:75930903-75930925 AATATTAAGCAGAGAGTAGAAGG - Intergenic
1141078698 16:81032183-81032205 GATTTGAAGGACAGAATAGAAGG - Intronic
1141680913 16:85543311-85543333 GATTCTATAGAGATAGCAGAGGG + Intergenic
1142509379 17:384928-384950 GTTTTTCAGGAGATGGGAGATGG + Intronic
1143157734 17:4849137-4849159 GACTTTCAGGAGATGGTAGGAGG - Intronic
1149957941 17:61074316-61074338 GATTTTGAGGAGATAATATCTGG + Intronic
1150113692 17:62525317-62525339 GGTTTTTATGAGACAGTAGAGGG - Intronic
1150871429 17:68916082-68916104 GATTTTATGGAGATAGTAGAAGG + Intronic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1153157476 18:2166113-2166135 GATTTTAAGGATTTTGTAGTGGG + Intergenic
1153969811 18:10215946-10215968 GAGCTTGAGGAGTTAGTAGAAGG + Intergenic
1155154937 18:23150179-23150201 TATTTTAAGGTCATAGTAGTTGG + Intronic
1155173946 18:23286992-23287014 GGTTTTAAGGAGATGGTAAGGGG - Intronic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155696899 18:28695886-28695908 GGTTTTAAGGAGATGGTAAGGGG + Intergenic
1155714583 18:28925700-28925722 GATTTAAGGGAGATATTTGAGGG + Intergenic
1156295583 18:35786782-35786804 GGTTTTAAAGAAATAGAAGAGGG + Intergenic
1156581368 18:38380487-38380509 AATTTTAAGGAGTTTGGAGAGGG - Intergenic
1157885544 18:51362751-51362773 GTATTTATGGAGATAGTAGAAGG - Intergenic
1158482695 18:57836005-57836027 GATCTGAAGGAGAGAGTAGGGGG - Intergenic
1158872727 18:61704039-61704061 GATTTTAGGGGGATAGTTAAGGG + Intergenic
1159003270 18:62991746-62991768 GATATGAAGGAAATAGAAGAGGG + Intergenic
1159704470 18:71669370-71669392 CATTTTAAAGAGATTTTAGAAGG + Intergenic
1162219840 19:9167190-9167212 GATTTTAAGGAGTCACTAAATGG - Intergenic
1164567880 19:29341056-29341078 GATTTTAAGGAGAAAATGAAGGG - Intergenic
1164967153 19:32495315-32495337 GAACTCATGGAGATAGTAGAAGG + Intergenic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
1165314284 19:35045270-35045292 GATTTTACGGAGTAGGTAGAGGG + Intronic
1165835482 19:38752548-38752570 GATTTTAATGAGATGGTAAGGGG - Intronic
925621124 2:5793939-5793961 GCTTTTAAGGGGATAGGAGCAGG - Intergenic
929431086 2:41887213-41887235 TATTTTAATGGGTTAGTAGAGGG - Intergenic
930113606 2:47699884-47699906 ACTTTTATGGAGATAGTAGATGG + Intronic
930540453 2:52699496-52699518 GATTTAGACAAGATAGTAGAAGG - Intergenic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
931625905 2:64255471-64255493 GGTTTTAATGAGATAGTAAGGGG - Intergenic
932119616 2:69086541-69086563 GATTTCAAAGAGAAAATAGATGG - Intronic
932355680 2:71066573-71066595 GATTTAAAGAAGAAAGTAGCCGG - Intronic
933976708 2:87517871-87517893 AATTTTAGGGAGATATGAGATGG - Intergenic
935163576 2:100550021-100550043 GATTTTGAGAAGAGAGGAGAAGG + Intergenic
936317109 2:111432933-111432955 AATTTTAGGGAGATATGAGATGG + Intergenic
936662316 2:114556031-114556053 AGTTTTAAGGAGATGGCAGAAGG + Intronic
938816726 2:134912133-134912155 GAATTCATGGACATAGTAGAAGG - Intergenic
940493080 2:154390138-154390160 AATTTTAAATAGATATTAGATGG - Intronic
940508664 2:154586006-154586028 GGTTTTAAGGGGATAGTAAGGGG + Intergenic
941172211 2:162152936-162152958 GATTTTAAATATATATTAGAAGG - Intergenic
941194301 2:162428062-162428084 TATTTTAAGAAGCTAGTAAAAGG - Intronic
943990203 2:194679539-194679561 GATAGAAAGGAGATGGTAGATGG + Intergenic
944163718 2:196694392-196694414 GATTTTAAGTAAATACCAGAAGG + Intronic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
945938448 2:215925314-215925336 GATTTTAATGAGATGGTAAGGGG - Intergenic
946104224 2:217355223-217355245 GATTTAAAGTAGATGGTAAAGGG + Intronic
946505894 2:220300253-220300275 GAATTTAAGGAGAAAACAGAAGG - Intergenic
946699321 2:222395659-222395681 TATTTTCAGGAAATAATAGATGG + Intergenic
946886618 2:224228228-224228250 GATTTTAATGAGATGGTAAGGGG - Intergenic
947516109 2:230806505-230806527 GACTTTCAGAAGACAGTAGATGG + Intronic
1170439352 20:16362883-16362905 GATTTTAACCAGATAGTAAAAGG + Intronic
1171029327 20:21663185-21663207 GATGCTAAGGAGATAATTGATGG + Intergenic
1171305174 20:24098972-24098994 AATTTTATGGAGAAAGAAGAAGG + Intergenic
1173032670 20:39376825-39376847 GATTATAAGGAAAGAGAAGAAGG + Intergenic
1173814605 20:45977397-45977419 TATTTTAAGGAGATAGAAGAAGG - Intergenic
1173884311 20:46443959-46443981 GATTTTAAGGAGTTAGATGTGGG - Intergenic
1175256954 20:57653297-57653319 GATTTTCAGGGGACAGCAGAGGG - Intronic
1178184779 21:30206983-30207005 GGTTTTAAGGAGCTAGGAGTGGG + Intergenic
1179030494 21:37715642-37715664 GCCTTTAAGGAGATAGTTAAAGG + Intronic
1181820888 22:25474784-25474806 GAATTTATGGAGACAGTAGAAGG + Intergenic
1182627434 22:31657900-31657922 GAACTCATGGAGATAGTAGAAGG - Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183796548 22:40123168-40123190 GATTTTAAGAAGTGAGTGGAGGG + Intronic
1184420338 22:44378446-44378468 GATTGAAAGGAGAGAGGAGAGGG - Intergenic
949117855 3:349522-349544 GATTTTCACGTTATAGTAGAAGG + Exonic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
951403876 3:22269873-22269895 GATCTTAAGGAGACAATACAAGG - Intronic
952332177 3:32374162-32374184 GAGTTAAATGAGATAATAGATGG - Intergenic
952528557 3:34239620-34239642 GATTTTGTGTAGATAGTAAAGGG + Intergenic
952571301 3:34720682-34720704 GAATTCATGGAGATAATAGAAGG - Intergenic
952613126 3:35235343-35235365 GATATTAATGAGAGAGTTGAAGG - Intergenic
953111349 3:39942807-39942829 GCTGGGAAGGAGATAGTAGAGGG - Intronic
953614831 3:44480452-44480474 CATTTTAATGAGATTTTAGAAGG + Intergenic
955188354 3:56736553-56736575 GATCTTAATAAGATATTAGAAGG - Intronic
955424325 3:58771603-58771625 GTTTTTAAGGACAAAGTAGAAGG - Intronic
957389688 3:79548139-79548161 GCTTGTTAGGAGATAGTAGCAGG + Intronic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
957985816 3:87572277-87572299 GGTTTTAATGAGATAGTAATGGG - Intergenic
958446586 3:94222989-94223011 GAATTTAAGGAGAAACTTGAAGG - Intergenic
959178493 3:102948618-102948640 GAATTTAAAGAAATAGGAGAGGG - Intergenic
960877664 3:122313379-122313401 GGTTTTCAGGAGAAACTAGAAGG + Intergenic
961687941 3:128647926-128647948 GAATTTTAGGAGCTAGCAGAAGG - Intronic
963376558 3:144473537-144473559 GAATTTAACGAAATAGTAAATGG + Intergenic
964055699 3:152453781-152453803 GATTTTAGAGAGATAGTATAAGG + Intronic
964907160 3:161731440-161731462 TATTTTCAGGAGAAAGCAGAGGG + Intergenic
966140914 3:176754461-176754483 CATTTTAGGAAGAAAGTAGAAGG - Intergenic
966480377 3:180401582-180401604 GATTTTAAGGTGAAAGTTGAAGG - Intergenic
968162851 3:196441114-196441136 GCTTTTAAGGAGAAAGAAGGAGG + Intergenic
970626986 4:17896904-17896926 GAACTCATGGAGATAGTAGAAGG - Intronic
971791933 4:31181237-31181259 GATTTTTAGGAGATATTAATAGG - Intergenic
972071007 4:35019552-35019574 GGTTTTAACGAGATAGTAATGGG + Intergenic
972713485 4:41622339-41622361 GCCTTTAAGGACATAGTAGTAGG + Intronic
973661914 4:53116819-53116841 GTTTTGAGGGAGATGGTAGAAGG + Intronic
974117133 4:57592647-57592669 TATTTTAAAGAAATACTAGATGG + Intergenic
974278012 4:59751743-59751765 TATTTTAAGCAGATAGATGAGGG - Intergenic
974991434 4:69095255-69095277 GGTTTTAAGGAGATCATAGATGG + Intronic
975185587 4:71398529-71398551 TATTTTAAGAATATAGTATATGG + Intronic
975482712 4:74899404-74899426 AACTTTAAGAAGATAGTTGAAGG - Intergenic
975863889 4:78706107-78706129 GAGTTGAAGGAGCTAGGAGAGGG + Intergenic
977662540 4:99607583-99607605 GATTTGAGGGAGTTAGTAAAAGG + Intronic
978141045 4:105317738-105317760 CATTCTAAGGAGATCTTAGAAGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978874702 4:113625471-113625493 AATTTTAAGGAGAGACCAGAAGG + Intronic
980771074 4:137373999-137374021 GATTTTAAGGAAATAATGGAGGG + Intergenic
981308555 4:143272210-143272232 GCTTTGAAGGAGATAGCGGATGG - Intergenic
981468980 4:145107858-145107880 TATTTTAAGTAAATAGTAGAAGG + Intronic
981876896 4:149557778-149557800 GACTTTAAGGAGATTGGAGGGGG - Intergenic
981940861 4:150280338-150280360 GGTTTTAAGGAGGTAGTAGCAGG + Intronic
982054838 4:151538136-151538158 GAGTATAAGGAGATGGTTGAGGG + Intronic
982975212 4:162047877-162047899 TATTTTAAGGACATACTATATGG - Intronic
985410656 4:189680027-189680049 GCTTTTAAGCAGATAGAGGAAGG - Intergenic
986401893 5:7390198-7390220 GTTTTTAAAGATATAGTGGAGGG + Intergenic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
987673879 5:21049501-21049523 GTTTTTGATAAGATAGTAGAAGG + Intergenic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990772274 5:59262085-59262107 TATTCCAAGGATATAGTAGAAGG + Intronic
990886977 5:60605785-60605807 TATTTTCAGGAGGTAGGAGAAGG + Exonic
993357087 5:86927741-86927763 GATTTCAAGAAGCTAGAAGAAGG - Intergenic
993425909 5:87764068-87764090 AGTTTTTAGGAGATAGCAGAAGG - Intergenic
995661237 5:114485406-114485428 GCTTTTAAGGAGAGAGGAGTGGG - Intronic
995820192 5:116221276-116221298 GATTTTAAGGAGATAGTAGAGGG - Intronic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996429502 5:123356585-123356607 GATTAAAAGGAGAGAGAAGAAGG - Intronic
996440025 5:123479713-123479735 GGTTTTAATGAGAAAGTATATGG - Intergenic
996657832 5:125962719-125962741 GCTTTTAAGCAAATAGAAGAAGG + Intergenic
997103028 5:130989443-130989465 TATTTTATGGAGATATTAAAAGG + Intergenic
997871422 5:137508741-137508763 GACTTTAAGGAGAAATTACATGG - Intronic
999983439 5:156979695-156979717 GATTTTTAGCAGAAAGTAGTGGG - Intergenic
1002120419 5:176999584-176999606 GAGCTAATGGAGATAGTAGAAGG - Intronic
1003026661 6:2560977-2560999 GATTTCAAGAGGAAAGTAGAAGG + Intergenic
1003094357 6:3131024-3131046 GAATTTAAGGATACAGGAGAGGG - Intronic
1003299231 6:4861900-4861922 GATTTTAAGGAGATGGTCATGGG - Intronic
1003326953 6:5099169-5099191 GATTTGAAGGGGTTAGTTGAAGG + Intergenic
1003466138 6:6381941-6381963 TGTTTTAAGGAGATAAAAGAAGG + Intergenic
1004077723 6:12360254-12360276 GATTTTAAGGAGCTACTATATGG - Intergenic
1004669908 6:17785980-17786002 CATTTTAGGGACATAGTGGATGG - Intronic
1008215713 6:48785942-48785964 GAACTCATGGAGATAGTAGAAGG + Intergenic
1008465750 6:51828925-51828947 CATTTTTTGGAGATAGAAGAGGG + Intronic
1009165913 6:60340757-60340779 CATTTTAATGAGAAAGTAGAAGG - Intergenic
1009569438 6:65364639-65364661 CATTTTAACGAGATAGTTCAGGG + Intronic
1011659086 6:89578723-89578745 GATTTCAACCAGATAGTATATGG - Intronic
1012485378 6:99715554-99715576 GAACTTAAGGAGACAGTAGAAGG - Intergenic
1013095546 6:106941406-106941428 GACTTTAAGGAGATTTTGGAGGG + Intergenic
1013407767 6:109858537-109858559 GGTTTTAATGAGATAGTAAGGGG + Intergenic
1014879241 6:126701970-126701992 GACTTTTAGTTGATAGTAGAGGG + Intergenic
1015088981 6:129331223-129331245 GAATTTAAGGTGAGATTAGATGG - Intronic
1016665570 6:146635970-146635992 TATCTTGAGGAGATAGTAGGAGG - Intronic
1017269929 6:152493146-152493168 GATTTTAATGGGATAGTAATGGG - Intronic
1018077730 6:160231433-160231455 GATTTTAATGGGATAGTAATGGG - Intronic
1018274962 6:162120589-162120611 TATTTTACGGAGATTGCAGAAGG + Intronic
1018305121 6:162446892-162446914 GACTTTAAAGAGGTAGTAGGTGG - Intronic
1021393743 7:20123532-20123554 GATTTTAATGAGATGGTAAGGGG - Intergenic
1021593147 7:22286527-22286549 GATTTTAAGTAAATATGAGATGG + Intronic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1022205761 7:28162047-28162069 GGTTTAATGGAGAGAGTAGATGG - Intronic
1022754075 7:33266335-33266357 GATTTTAATAAGATAGTTGTGGG + Intronic
1023318342 7:38965496-38965518 GATTTTAAAAAGATTGTAAAAGG - Intergenic
1024943660 7:54787362-54787384 GATATTAAGGAAATTATAGATGG - Intergenic
1026580380 7:71611260-71611282 GATTTCAATCAGACAGTAGAGGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026897478 7:74018583-74018605 GATTTCAAGGAGAGAGCACAAGG + Intergenic
1028569596 7:92271977-92271999 GATTTCATGGAGATAGAAAATGG + Intronic
1030441564 7:109594798-109594820 GATTTTAATGAGATGGTAAGGGG + Intergenic
1030816352 7:114042372-114042394 GATTGGAAGGACATAGTACAAGG + Intronic
1031111734 7:117618675-117618697 TATTTTAAGGAGATACTGAACGG - Intronic
1031390580 7:121209102-121209124 AATTTTAAGAAAATAGTAAATGG + Intronic
1031633337 7:124070885-124070907 GTTTATGAGGAGAGAGTAGAGGG - Intergenic
1032043392 7:128581080-128581102 GGTTTTTACGAGACAGTAGAGGG - Intergenic
1033088671 7:138365483-138365505 GATTTTAATGAGATGGTAAGGGG - Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033819517 7:145117112-145117134 GAATTCATGGAGAGAGTAGAAGG - Intergenic
1033943699 7:146687383-146687405 GGTTTAAATGAGATAGTACATGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034017296 7:147600781-147600803 TATTTTAGGGACATAGTAGTAGG - Intronic
1037352246 8:17973407-17973429 GAGTTTAAGGAGATAGTATTTGG + Intronic
1037932413 8:22889467-22889489 GAGTTTAGGGAGATGGTAAATGG + Intronic
1040136968 8:43865882-43865904 CATTTAAAGCAGATTGTAGAGGG - Intergenic
1040945442 8:52880358-52880380 AATTTTAAGGGGATTGTAGTGGG + Intergenic
1041070342 8:54122458-54122480 CATTTGAAGGAGAAAGTAAAAGG - Intergenic
1042021321 8:64373299-64373321 AATTTCAAGCAGAAAGTAGAAGG + Intergenic
1042349558 8:67763295-67763317 GATTTGAAGGAGGAAGGAGAAGG - Intergenic
1043098897 8:76014436-76014458 GACTTTTAGGAGAGAGAAGAAGG - Intergenic
1044148397 8:88744986-88745008 GGTTTTAATGAGATGGTAAAGGG + Intergenic
1044311138 8:90694176-90694198 GATGTTAAGGAAATAGTTAAAGG + Intronic
1046959441 8:120094917-120094939 CATTTTAATCAGATAGCAGATGG - Intronic
1048480775 8:134790606-134790628 GAGTTTAAGGAGAAAACAGAAGG - Intergenic
1048941885 8:139406919-139406941 GTTTTCAAGGAGAAAGTAGCTGG + Intergenic
1051245988 9:15111589-15111611 GAATTAAATGAGATAATAGAAGG + Intergenic
1051472020 9:17454365-17454387 GATGTTTAGGAGACTGTAGACGG + Intronic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1052495168 9:29214821-29214843 GATTTTGAGGAGATTCTCGATGG - Intergenic
1053127499 9:35594658-35594680 GATCTTACGGTGATAGAAGAAGG - Intergenic
1055347595 9:75354557-75354579 GGTTTTAATGGGATAGTAAAGGG + Intergenic
1056045464 9:82711067-82711089 GATTTACAGGATATAGTACATGG - Intergenic
1056321574 9:85440242-85440264 GATTTTACGTAGAAAGTAAAGGG + Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1058304714 9:103424708-103424730 GATCATAAGGAGATAATAGTGGG + Intergenic
1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186392299 X:9173198-9173220 GAATTCAAGGAGAAAGTGGATGG - Intergenic
1189316989 X:40063513-40063535 GCTTTTGAGGAGATCTTAGAAGG - Intronic
1191612225 X:63129615-63129637 AATTTTAAGGCATTAGTAGAAGG + Intergenic
1191624072 X:63249311-63249333 AATTTTAAGGCATTAGTAGAAGG - Intergenic
1194024337 X:88733548-88733570 GATTTTTTGTAGATAGCAGATGG + Intergenic
1194367223 X:93025868-93025890 GATTTTAATGAGATGGTAAGGGG - Intergenic
1194557892 X:95384908-95384930 GAACTCATGGAGATAGTAGAAGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1197351934 X:125391619-125391641 GGTTTTAATGAGATGGTAAAGGG + Intergenic
1198510118 X:137341935-137341957 TAGTTTAAGGAGAAAGGAGAAGG + Intergenic
1198968699 X:142255145-142255167 GATATTAAGGAGTTATTTGAAGG + Intergenic
1199343722 X:146713552-146713574 GTTTTAAGGGAGAGAGTAGATGG - Intergenic
1200675437 Y:6142125-6142147 GATTTTAATGAGATGGTAAGGGG - Intergenic
1201409911 Y:13689226-13689248 GATTATGAGGAGATAGGAGAAGG - Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic