ID: 995820802

View in Genome Browser
Species Human (GRCh38)
Location 5:116229557-116229579
Sequence GCAACACTGTTAGCTGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995820802 Original CRISPR GCAACACTGTTAGCTGCTAA AGG Intronic
905709866 1:40092634-40092656 GCAAAACAGTTATCTGATAAGGG + Intronic
907677575 1:56532823-56532845 GCTACCCTGTTAGCTGCACAGGG - Intronic
915681291 1:157584245-157584267 GCAAAACTGCAAGCTGCCAAGGG - Intronic
918719450 1:187835023-187835045 GCAAAACTTTTATCTGATAAAGG + Intergenic
920715739 1:208338403-208338425 GCAACTCTGCTAGTTCCTAAGGG + Intergenic
921058498 1:211563040-211563062 GGAACACTGCTAGCTGCTCTGGG - Intergenic
921831577 1:219733255-219733277 CCAACACTCTTAGCAGCTGAAGG + Intronic
1065873497 10:29976665-29976687 GCATCACTGATAACTGATAAAGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1068591416 10:58856684-58856706 GCAGCTCTGTTAGCTGTGAATGG + Intergenic
1068596598 10:58908808-58908830 GCAGAAGTGTTAGCTGCTGAAGG + Intergenic
1070871328 10:79756055-79756077 CCAACACTCTCAGCAGCTAAGGG + Intergenic
1071638264 10:87278263-87278285 CCAACACTCTCAGCAGCTAAGGG + Intergenic
1071656980 10:87459689-87459711 CCAACACTCTCAGCAGCTAAGGG - Intergenic
1072434716 10:95404589-95404611 GCCACACTATTAGCAGCTCAAGG + Intronic
1072662082 10:97369386-97369408 GCCACCCTGCTACCTGCTAAGGG + Intronic
1073703483 10:105956453-105956475 TCAACACTTTCAGCAGCTAAGGG + Intergenic
1077634406 11:3832392-3832414 GTCACACAGTTAGCTGGTAAGGG - Intronic
1081244468 11:40747050-40747072 GCATCAGTGTTAGCTGGTAAAGG - Intronic
1081731385 11:45374209-45374231 ACAACATAGTTTGCTGCTAAGGG + Intergenic
1084702860 11:70798863-70798885 GCAACACTGAGAGATGCTACAGG - Intronic
1085204972 11:74726148-74726170 GCAGCTCTGTTACCTGTTAAAGG + Intronic
1085220821 11:74872534-74872556 GCCACACTGGTAGCAACTAATGG - Intronic
1085753205 11:79180455-79180477 GCAACACTGCTAGTTCATAATGG - Intronic
1086463434 11:87029221-87029243 GCAAGACTGTCAGTTGCAAAAGG + Intergenic
1086593519 11:88543837-88543859 GCAACCATGTTATCTGCTATGGG - Intronic
1091934003 12:4420736-4420758 CAATCAATGTTAGCTGCTAATGG - Intergenic
1092164520 12:6334819-6334841 CCAGCACTGTTAGCTGCTGTGGG - Intronic
1094180081 12:27583277-27583299 GGAACACTGTTAGATGCTTCTGG + Intronic
1097720555 12:63015764-63015786 GCAACACTGTCAGCTTCATAAGG - Intergenic
1098568441 12:71961557-71961579 CCAAGACTGTTAGCTGCTATTGG + Intronic
1100670660 12:96808865-96808887 GCAACCCTGTTAGCATATAAGGG - Intronic
1100721415 12:97362749-97362771 GGGACACTGTTAGCTTCTAGAGG + Intergenic
1101047953 12:100830225-100830247 GCAACACAGTTTGCTGTTAAAGG + Intronic
1101917936 12:108910723-108910745 GCCACAATGTTGGCTGCCAACGG + Intergenic
1106344930 13:28867167-28867189 GCAACATTTTTAGCTTCTGAAGG + Intronic
1109101552 13:58190711-58190733 GCAACACTCCTAGCAGCTGAGGG - Intergenic
1115084482 14:29497489-29497511 AGAACACTGGAAGCTGCTAAGGG - Intergenic
1117414040 14:55477374-55477396 GGAACACTCTTAGCTGCCAGAGG + Intergenic
1124832139 15:33159421-33159443 ACAACACTGCTAGATGCAAAGGG + Intronic
1130374813 15:83319441-83319463 GCAAAACTCTTTGCTGCTAGAGG - Intergenic
1135545812 16:23365683-23365705 GCCACACTGGAAGCTGCAAAAGG + Intronic
1140529875 16:75655792-75655814 TCAAGACTGTAAGCTCCTAAGGG - Intronic
1141337073 16:83166076-83166098 GCATCACTGCCTGCTGCTAATGG - Intronic
1148587734 17:48792765-48792787 GCAACACTGTTTTCTGACAATGG - Intronic
1153046241 18:857784-857806 ACAACAAAGTCAGCTGCTAAGGG + Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1153486590 18:5604944-5604966 GCAGCACTTTTAGCAGCTAGAGG - Intronic
1154106957 18:11531941-11531963 GCAAGACTGGTAGCTGCTCTGGG + Intergenic
1155917094 18:31567711-31567733 GCAATACTGATACCTGTTAAAGG + Intergenic
1158227388 18:55215224-55215246 CCAAGACTGTCAGCTGCTTAAGG + Intergenic
1160243409 18:77138404-77138426 GCGACACTGTGAGCTCCTCAAGG + Intergenic
1160490787 18:79335414-79335436 GCAACAGTTTTAGCTGGTGATGG - Intronic
1165829459 19:38723309-38723331 GCCACACTCTTAGCTGATAGTGG + Intronic
926133472 2:10320046-10320068 GCAAGACTGGGAGCTGCAAAGGG - Intronic
927272764 2:21230827-21230849 ACCAGACTGTAAGCTGCTAAAGG + Intergenic
928951082 2:36813505-36813527 CCAACACTGTTGGGTGCTACAGG - Intronic
929556031 2:42926156-42926178 GCTGCACTGCTAGCTGCTCAGGG - Intergenic
931030056 2:58164470-58164492 TCAACACTGTCATCTGGTAATGG + Intronic
935063803 2:99631027-99631049 GAAACACTGTGAGCTGCTGCAGG + Intronic
935530366 2:104225185-104225207 GCAACATTCTTAGCTTATAAAGG - Intergenic
935760361 2:106314788-106314810 GGACCTATGTTAGCTGCTAACGG - Intergenic
935900686 2:107788906-107788928 GCTACACTGTTTGCTCCAAAAGG - Intergenic
939774450 2:146367206-146367228 TTAACAATGTTAGCAGCTAATGG + Intergenic
940043336 2:149384016-149384038 TCTACACTGTGAGCTGCTCAAGG + Intronic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
943227859 2:185204371-185204393 GTAACACTGATAACTGCTGATGG + Intergenic
947463743 2:230323971-230323993 GCAACACTGTAAGATGCCAGTGG - Intergenic
1169179134 20:3546978-3547000 GCAGAACTGTTAGCTCCTCATGG - Intronic
1169537790 20:6564520-6564542 GCATGAATGTTGGCTGCTAATGG + Intergenic
1175088118 20:56478202-56478224 GAGCCACTGTGAGCTGCTAAAGG - Intronic
1175256872 20:57652945-57652967 GGAACAGTGTGGGCTGCTAAAGG - Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1184528220 22:45038074-45038096 GGAACACTGTCACCTGCCAATGG - Intergenic
1184528234 22:45038175-45038197 GGAACACTGTCACCTGCCAATGG - Intergenic
1184528249 22:45038297-45038319 GGAACACTGTCACCTGCCAATGG - Intergenic
951482318 3:23174540-23174562 GCTGCACAGTTGGCTGCTAATGG + Intergenic
951525164 3:23646482-23646504 GCACCACTGTTGGCTGCTTTAGG + Intergenic
954434994 3:50491241-50491263 GCACCACTGTCAGCTGCAGAAGG + Intronic
955149484 3:56352874-56352896 GCCACATTGTTAGCTGCCTATGG - Intronic
956302385 3:67786482-67786504 GGAACCCTGTTAGGTGCTCAGGG + Intergenic
959370454 3:105518201-105518223 AAAACACTGTTAGTTGCCAAAGG + Intronic
964733094 3:159888147-159888169 GCAACAATATTAGCTGCCACGGG + Intronic
965819682 3:172672785-172672807 GCCACACTGATAGCAACTAATGG - Intronic
969501897 4:7558569-7558591 GCAGCACTGTCAGATGCTCAAGG - Intronic
969666490 4:8560373-8560395 TCAACACTGTCAGCAGCTTAAGG + Intronic
971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG + Intergenic
971167586 4:24199879-24199901 GGAACACTGTTATCAGCAAAAGG + Intergenic
975952077 4:79786177-79786199 ACAACACTGTTAACTCCTGAGGG - Intergenic
977984548 4:103366624-103366646 CAAATACTGTGAGCTGCTAATGG + Intergenic
978165607 4:105603091-105603113 ACCAAACTGCTAGCTGCTAAAGG - Intronic
979676229 4:123413184-123413206 GCAACACTGCATGCTGCTGATGG + Intergenic
980169051 4:129264778-129264800 ACAACACTGTCATCTCCTAAAGG + Intergenic
980201750 4:129664444-129664466 ACTACACTGTTAGCTTCCAAAGG - Intergenic
981128796 4:141134870-141134892 GAAACACTGTGGGTTGCTAAAGG - Intronic
981767152 4:148263869-148263891 GCAAGAGTGGTAACTGCTAAAGG - Intronic
982028510 4:151276358-151276380 CCAACACTCCTAGCTGCTAAGGG - Intronic
984031021 4:174604223-174604245 ACAACACTGTTAGTTCCAAAGGG + Intergenic
984087467 4:175330436-175330458 CCAAGAATGTTAGCTGCTGAAGG + Intergenic
989315605 5:40074950-40074972 GGAACACTCTTAACTGCTGAAGG + Intergenic
992123164 5:73615015-73615037 ACAACACTGTTAGATACTAGAGG - Intergenic
992123258 5:73615769-73615791 GTAACATGGTTAGCTGCAAATGG + Intergenic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
996192040 5:120556619-120556641 GCAACACTCTTACATGCAAATGG - Intronic
999158081 5:149472699-149472721 GCAAGGCTGTTACCTGCTTATGG + Intergenic
1000870409 5:166570134-166570156 GTCACACTGTTAGCTACTAGGGG + Intergenic
1004084010 6:12426296-12426318 TCAACACTGTCTGCTGCTGATGG - Intergenic
1004317881 6:14606527-14606549 GCCACACTGTGAGCTGCCTAGGG - Intergenic
1014987175 6:128025720-128025742 GCAGCACTGGTAGCTGGAAAAGG - Intronic
1017567304 6:155701415-155701437 GCAGCACTGTTATCTGCTTTGGG - Intergenic
1019416363 7:928612-928634 TCAACACTGTTAGCTGTCAGGGG + Intronic
1020469326 7:8517862-8517884 GCAACTCTGTTCACTCCTAACGG - Intronic
1028703098 7:93806244-93806266 GCAACAGTGCTATCTGTTAATGG + Intronic
1031594782 7:123637485-123637507 GCAACAATGTTAGATGCTGTAGG - Exonic
1032242987 7:130180174-130180196 TCAACTCTCTTATCTGCTAAAGG - Intronic
1032301054 7:130687540-130687562 GCTAAACTGTGAGCTCCTAAAGG - Intergenic
1032720210 7:134545457-134545479 GCAACACTGTAAGATTTTAAGGG - Intergenic
1033305315 7:140221106-140221128 GTAACACTGCTTGCTGCCAAAGG + Intergenic
1034499053 7:151438464-151438486 GCCCCACTGTGAGCTCCTAAGGG - Intronic
1035093646 7:156334466-156334488 GCAACCCTGGTAGCAGCTGAGGG + Intergenic
1035759189 8:2056783-2056805 TCAAAACTGTTAGGTGCTACTGG - Intronic
1038349582 8:26763684-26763706 ACTACACTGTTAGCTAGTAACGG + Intronic
1039221846 8:35340335-35340357 GGAACACTGTAAGCTGTTGAGGG + Intronic
1043488044 8:80718389-80718411 ACTACAATGTTAGCTGATAAAGG - Intronic
1043791774 8:84477290-84477312 GCAACAGCGTTAGATGCTAAAGG - Intronic
1043916910 8:85933498-85933520 GGAACACTTTTAGCAGGTAAGGG - Intergenic
1045612059 8:103856179-103856201 GCAACTCTGTTATCTGATATAGG + Intronic
1046210534 8:111068435-111068457 GCAAGACTGCTAGTTGCTGACGG - Intergenic
1046630479 8:116618433-116618455 TCAAGACTATTAGCTGTTAAAGG + Intergenic
1048003774 8:130401581-130401603 GCAACACTATAAGGTGCTATAGG - Intronic
1056555525 9:87684292-87684314 GCAACACTGTCACCTGCCAGGGG + Intronic
1057254250 9:93531459-93531481 GCAACAATCTTAGCTGCCAAAGG + Intronic
1057364129 9:94402813-94402835 GCAAAACTATTAGCTTCTAGAGG - Intronic
1057659209 9:96985250-96985272 GCAAAACTATTAGCTTCTAGAGG + Intronic
1187077220 X:15947206-15947228 GCAACACTCATAGCAGCTAAGGG - Intergenic
1187351184 X:18518936-18518958 GTAACATTATTAGCTGATAATGG + Intronic
1189006570 X:37000576-37000598 GCAACACTGAGAGCAGCTACTGG + Intergenic
1189042068 X:37553434-37553456 GCAACACTGAGAGCAGCTACTGG - Intronic
1190628867 X:52365772-52365794 GCAACTCTGAGGGCTGCTAAAGG - Intergenic
1194388285 X:93284442-93284464 GCTACACTCTTAGGTGCTGAAGG - Intergenic
1197805819 X:130397626-130397648 GTAACACCGTGAGCTGCTCAAGG + Intergenic