ID: 995827534

View in Genome Browser
Species Human (GRCh38)
Location 5:116317395-116317417
Sequence GTTCAACAGCAACATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 17, 3: 41, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995827534_995827535 -7 Left 995827534 5:116317395-116317417 CCTACAGCATGTTGCTGTTGAAC 0: 1
1: 0
2: 17
3: 41
4: 184
Right 995827535 5:116317411-116317433 GTTGAACAACCTCTTTCATATGG 0: 1
1: 0
2: 0
3: 70
4: 262
995827534_995827539 28 Left 995827534 5:116317395-116317417 CCTACAGCATGTTGCTGTTGAAC 0: 1
1: 0
2: 17
3: 41
4: 184
Right 995827539 5:116317446-116317468 AGTAACAGAGCAGAGTTTCCAGG 0: 1
1: 22
2: 56
3: 73
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995827534 Original CRISPR GTTCAACAGCAACATGCTGT AGG (reversed) Intronic
900361724 1:2292428-2292450 GTTCATCAGGGACCTGCTGTGGG + Intronic
901496224 1:9623764-9623786 CTTCAGCAGCCACCTGCTGTTGG + Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
905099626 1:35507851-35507873 GTACAACAGTGACATGCTATGGG + Intronic
907933720 1:59023173-59023195 TTTCAATACCAACATGCAGTGGG + Intergenic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916614995 1:166430207-166430229 TTCCAATAGCAACTTGCTGTGGG - Intergenic
918466105 1:184823018-184823040 CTGCAACAGGAACATGCTGGAGG - Intronic
919661035 1:200247574-200247596 ATTAAACAGCAACATGTGGTGGG + Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922771482 1:228186290-228186312 GTACAACAGCGGCATGCTCTTGG + Intergenic
923271575 1:232359568-232359590 GTTCAGCAGCGACTTGCTGAGGG + Intergenic
923724916 1:236497395-236497417 GGTGCACAGCACCATGCTGTGGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1063936336 10:11082417-11082439 GTTCAACAGAAACGTACTGATGG + Intronic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1066188697 10:33036079-33036101 GTTCAAAAGTAAAATGATGTTGG + Intergenic
1068341281 10:55706775-55706797 GAACAACAGTAACAAGCTGTGGG + Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1071075769 10:81750705-81750727 ATTAAACACCAACATGCTGCCGG - Intergenic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1078862004 11:15257148-15257170 GTTAAACAGCCACATGGTCTTGG + Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1081560998 11:44216458-44216480 CTTCAATTTCAACATGCTGTTGG - Intronic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086139089 11:83474374-83474396 CTTCATCAGGAAAATGCTGTGGG + Intronic
1086552942 11:88073284-88073306 GTTCAACAGAACCATGCTACAGG + Intergenic
1086821845 11:91445393-91445415 TTTCAACAGAAACATGCAGGTGG + Intergenic
1088744532 11:112794565-112794587 GTCCAACAGCCGCATGCTGCCGG + Intergenic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1099122388 12:78707592-78707614 ATTCAATAGCAACGTTCTGTGGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1102619455 12:114182507-114182529 GGTCAGCACCAACTTGCTGTAGG + Intergenic
1104638892 12:130454800-130454822 GTTCCACATTCACATGCTGTGGG + Intronic
1105637773 13:22231989-22232011 CATCAAAAGCAAAATGCTGTTGG - Intergenic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109288840 13:60447835-60447857 GTTAAAAAGCAACATGTTGCGGG + Intronic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1111153052 13:84283951-84283973 GTTAAAAACAAACATGCTGTTGG + Intergenic
1111428663 13:88123804-88123826 GTTCAAGATCAAGCTGCTGTTGG - Intergenic
1111579711 13:90207412-90207434 ATTCAACAGCTAGATGCTATGGG + Intergenic
1112029544 13:95444481-95444503 GTTCTTCAGATACATGCTGTTGG + Intronic
1112507440 13:99983279-99983301 GTCCAACAGAAACAAGCTGCTGG - Intronic
1113198397 13:107836431-107836453 GTTAAACATTAACATTCTGTAGG + Intronic
1113933050 13:113978578-113978600 ATTCAACAGCAAAACGATGTGGG + Exonic
1115194345 14:30779863-30779885 CTCCAACAGCAACATGCTGATGG + Intergenic
1116482346 14:45406336-45406358 GTTCAAAAGAAAGATGCTTTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1116796963 14:49401610-49401632 GTTCAACAGCCACATGTGGCTGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1122993540 14:105250137-105250159 GTACCACAGGAAGATGCTGTGGG - Exonic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126550555 15:49924205-49924227 GTCTAACAGCAATATGCTGGGGG - Intronic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127678538 15:61269809-61269831 TTTCAACAGCCCCTTGCTGTGGG - Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1132251291 15:100337399-100337421 TTGCCACAGCCACATGCTGTAGG - Intronic
1132604983 16:789884-789906 GCTGGACAGCAACCTGCTGTGGG - Intronic
1134357066 16:13492212-13492234 CTTCCCCAGCAACATTCTGTGGG + Intergenic
1147323721 17:39660483-39660505 GTTCCACAGCACCATCCTCTCGG - Exonic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149856600 17:60088277-60088299 TTCCAACAGCAACATGAAGTTGG - Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150358434 17:64507299-64507321 GTGGAACAGCAGTATGCTGTGGG + Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156617848 18:38809141-38809163 GTTGAACACAAACATGATGTTGG + Intergenic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159440396 18:68471467-68471489 GTTCAAGAGGAACATACTGAAGG + Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1163368642 19:16889792-16889814 GTTCATCAGCAGCATGGTGGAGG - Exonic
1164726507 19:30469072-30469094 GGTCAACAGCACCATGTTGCAGG - Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166799587 19:45448192-45448214 GTTCCACACCCACAAGCTGTGGG - Intronic
1166974736 19:46599313-46599335 GTTCGTTAGCACCATGCTGTGGG - Intronic
1167087868 19:47322848-47322870 GTCCAACAGAAATATGATGTGGG + Intergenic
925084032 2:1093859-1093881 GTCCAACACCAAGGTGCTGTGGG + Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
929931361 2:46258637-46258659 TTTTAACAGCAAAGTGCTGTTGG + Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
932451885 2:71816043-71816065 CTCCAACAGCACCATTCTGTTGG - Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
936261575 2:110964165-110964187 GTTCAACAGCAACATGCAAAGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943659505 2:190543260-190543282 GTTCATCAGCACTGTGCTGTCGG - Intergenic
943802181 2:192074678-192074700 GGTCAACAGCAACATGTAGCTGG + Intronic
943955282 2:194180758-194180780 CTTCAACAGCATGAAGCTGTGGG + Intergenic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
944999078 2:205329599-205329621 GTTAAGAAGCAACATGCGGTAGG + Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946926171 2:224629444-224629466 GTTCACCAGGAACACGATGTGGG - Intergenic
947243029 2:228017253-228017275 GTTCTACAGGTACATGCTGAGGG - Exonic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1169735612 20:8834513-8834535 GTTCAAAAGCCACAGGCTGCTGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1174271311 20:49371373-49371395 GGCCAACAACACCATGCTGTTGG + Exonic
1175540607 20:59745397-59745419 GTTCACCAGCAAGATGCTCTGGG + Intronic
1178884958 21:36477806-36477828 GACCAACAGCAACATAGTGTGGG - Intronic
1179420410 21:41231543-41231565 TTTCAAAAGAAACCTGCTGTTGG - Intronic
1180581610 22:16844442-16844464 GTTCAACAGCAACCTCCACTGGG + Intergenic
1182074323 22:27484594-27484616 GCTCAAAAGCCACATGCAGTTGG - Intergenic
1182488866 22:30656411-30656433 GATAAACAGGGACATGCTGTTGG - Intronic
1183039960 22:35170564-35170586 GCACAACAGAAACATGCTGAAGG + Intergenic
1184327470 22:43800124-43800146 TTTCAGCAGTCACATGCTGTAGG + Intronic
951996565 3:28736441-28736463 AATCAACAGCAACAGGCTGGAGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
956470246 3:69559073-69559095 GTCAAACACCAACAGGCTGTAGG + Intergenic
957634937 3:82770274-82770296 GGTCAACAGCCAAATGCTGAAGG - Intergenic
957787820 3:84904797-84904819 ATTCAAAAGCAACGGGCTGTTGG + Intergenic
959661676 3:108875460-108875482 GATCAACAGCAAAATGCAGAAGG + Intergenic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
961917130 3:130388598-130388620 GTCCACCAGAAACATGATGTCGG - Exonic
962200731 3:133399382-133399404 GTTCATCAGCTGCTTGCTGTTGG - Intergenic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963033485 3:141003402-141003424 CTTCAACAGAATCATGCTATCGG - Intergenic
963448665 3:145448527-145448549 GTTCTACAGCAACAGGTAGTCGG - Intergenic
964612206 3:158626975-158626997 GATCAGCTGCAACATGTTGTCGG - Intergenic
964666188 3:159176024-159176046 GTTCAACAGCATCATTCGTTAGG - Intronic
964708982 3:159651760-159651782 GTTCAACAATAAAATGCTTTAGG - Intronic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968791467 4:2666612-2666634 ATTCACCAGCAAAATCCTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970931605 4:21518436-21518458 GCTGAACAGCAACCTGCTGGTGG + Intronic
971190179 4:24420733-24420755 GTTCAACAGCAAGAATCGGTTGG - Intergenic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
976084813 4:81396624-81396646 GCTCAACATCAACATGTTTTGGG - Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
976906795 4:90247059-90247081 GTCCAACAGATTCATGCTGTAGG - Intronic
977205645 4:94162303-94162325 GTTCAACAGAAAGATGTTGACGG - Intergenic
977836572 4:101652396-101652418 GTTGAACAGAAACAATCTGTTGG + Intronic
978630820 4:110742204-110742226 TTTCCAAAGCAACATGCTATAGG + Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979497869 4:121404903-121404925 TTTCAACAGCAACATACTAAAGG - Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983455562 4:167958751-167958773 CTTCAACAGCATCATGATATAGG + Intergenic
986341963 5:6796883-6796905 GCTCAACAGAACCATGCTCTTGG - Intergenic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
989357258 5:40557678-40557700 ATCCGAAAGCAACATGCTGTTGG - Intergenic
990831314 5:59961453-59961475 GTTCAAAATCAAGGTGCTGTAGG - Intronic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999195594 5:149779580-149779602 GATAAAAAGCAACATGCTCTGGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000582894 5:163055711-163055733 ATTCACCTGCAACATGCTTTTGG + Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001603847 5:172946234-172946256 TGTGAACAGCAACAGGCTGTGGG + Intronic
1002287280 5:178172549-178172571 GTTCAAGACCAACATGGGGTTGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1006275330 6:33000783-33000805 CTTCAGCAGCAACAGGCTGCAGG - Intergenic
1007182761 6:39942333-39942355 GTTAAACAGCAACTCACTGTAGG - Intergenic
1010527563 6:76922536-76922558 GTTCAGCAGCTACTTGCTATAGG + Intergenic
1011669512 6:89669777-89669799 ATCTAACAGCAACATGGTGTGGG - Intronic
1011790524 6:90893751-90893773 ATTCAAAAGCACCATGCTCTAGG + Intergenic
1012335916 6:98057318-98057340 GTTGAAATGCCACATGCTGTTGG - Intergenic
1014308745 6:119772236-119772258 GTTCAGCAGCAATGTGCTTTGGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1015332552 6:131997591-131997613 GTCCAAAATCAACATGCTGGTGG - Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1018337586 6:162810669-162810691 GCTCAACAGCAGAATGCAGTAGG + Intronic
1019489820 7:1307078-1307100 GTTTAACAGGAAGATGCTGGTGG + Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022413394 7:30156960-30156982 GTTCAACAGCAAAATGGTTATGG - Intronic
1023143766 7:37129027-37129049 GTCCAACAGGCACATGATGTGGG + Intronic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1026638569 7:72105325-72105347 GTTCACCAGCAAGAGGCTGCAGG - Intronic
1028008898 7:85614974-85614996 GTGCAACAGCAAAGTGATGTGGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1028971374 7:96862440-96862462 GTTCAATAGCCACATGAGGTTGG - Intergenic
1031205383 7:118750824-118750846 CCTCAACACCAACATGCTCTAGG - Intergenic
1032650483 7:133872778-133872800 GTTCAACAGCCTCTTACTGTGGG - Intronic
1035005165 7:155651948-155651970 TTTCTAAAGCAACATGGTGTAGG + Intronic
1035435364 7:158855666-158855688 GGTCAGAAGCAAGATGCTGTGGG + Intergenic
1035986516 8:4438482-4438504 GTTCCACAGCACCTGGCTGTAGG + Intronic
1039327815 8:36504253-36504275 GTCCATCAGCAACATTCTTTGGG + Intergenic
1039455893 8:37706338-37706360 TTTCAAAAGCAACTGGCTGTAGG - Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1046273779 8:111930259-111930281 GGTCAACAGCAACAGGCAGCAGG + Intergenic
1047011246 8:120674540-120674562 GCTGAACAGCAATAGGCTGTGGG + Intronic
1048572328 8:135666472-135666494 GCCCAAAAGCAACATGTTGTTGG - Intergenic
1048816027 8:138334316-138334338 GTTCTACAGCCACTTGCTGTAGG - Intronic
1049064666 8:140303539-140303561 GGTCAACAGCAACAGGATGTGGG + Intronic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1051663373 9:19445793-19445815 GTTAAACAGGAAGATGCTGGAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053348028 9:37392457-37392479 GATTAACAGCCTCATGCTGTGGG - Intergenic
1054790139 9:69248991-69249013 GTTCAACAACAACAAACTGAAGG + Intronic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1055998398 9:82188005-82188027 GTTCAACATCAAAAAGTTGTAGG - Intergenic
1057187519 9:93065166-93065188 GTTCAAAAGAAAAATGCTGGCGG - Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057346209 9:94252966-94252988 GTTCTCCAGCTACAAGCTGTAGG + Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060900202 9:127250354-127250376 TTTCAAAAGCAACATGGTGGTGG + Intronic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188553361 X:31384596-31384618 CTTCAACAGCAGCATACTGTTGG - Intronic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic