ID: 995833251

View in Genome Browser
Species Human (GRCh38)
Location 5:116376514-116376536
Sequence GATTCAAGGGAGCAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995833244_995833251 -7 Left 995833244 5:116376498-116376520 CCTGAAACTAGAAGAGGATTCAA 0: 1
1: 0
2: 0
3: 28
4: 285
Right 995833251 5:116376514-116376536 GATTCAAGGGAGCAGGGGGCAGG 0: 1
1: 0
2: 5
3: 35
4: 399
995833240_995833251 25 Left 995833240 5:116376466-116376488 CCTAGAACAGAAAGCAAGGTATA 0: 1
1: 0
2: 1
3: 22
4: 327
Right 995833251 5:116376514-116376536 GATTCAAGGGAGCAGGGGGCAGG 0: 1
1: 0
2: 5
3: 35
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995833251 Original CRISPR GATTCAAGGGAGCAGGGGGC AGG Intronic
900281091 1:1869529-1869551 GATTCACGGGAGGAGGAAGCAGG - Intronic
900682230 1:3923440-3923462 GATTAAAGGGTGCAGAAGGCCGG - Intergenic
900970855 1:5991917-5991939 GAGGCCAGGGGGCAGGGGGCAGG + Intronic
901403624 1:9031699-9031721 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
901672149 1:10862160-10862182 GATTCAGGGGAGTCGGGGGAAGG + Intergenic
901796498 1:11682452-11682474 GTTTGAAGGCATCAGGGGGCGGG - Intronic
902225405 1:14993613-14993635 GAGTCGAGGCAGCAGGGGGGTGG - Intronic
902620519 1:17648133-17648155 AATTCAAGGCAACAGGGGTCTGG + Intronic
903381905 1:22903040-22903062 GCATCTAGGGAGCAGGGAGCTGG + Intronic
903414972 1:23176359-23176381 AAGTCAAGGAAGTAGGGGGCTGG - Intronic
903652954 1:24932305-24932327 GATCCAAGGGACCAGGGCGGCGG + Intronic
903681965 1:25103252-25103274 GCTTCCAGGGAGCAGGGAGCTGG - Intergenic
904809264 1:33152830-33152852 GATTCAGATTAGCAGGGGGCGGG + Intronic
905986727 1:42291920-42291942 GATTCAGAGGAGCCGAGGGCAGG + Intronic
906112673 1:43334862-43334884 GATTCAAGTAGGCAGGGGCCAGG + Intergenic
906952860 1:50348790-50348812 GACTCACAGGATCAGGGGGCTGG - Intergenic
908260179 1:62334257-62334279 GATGCCAGGGTGCAGTGGGCTGG + Intergenic
908356443 1:63328321-63328343 GTTTCAAGGGAGGAGGCGACAGG + Intergenic
908490354 1:64637271-64637293 GAGTCAAGTGAGCTGGGGGAAGG + Intronic
909054693 1:70807169-70807191 GGGTCGAGGAAGCAGGGGGCTGG + Intergenic
912449124 1:109758773-109758795 GAGACCAGGGAGCAGGGGGTGGG - Intronic
913962596 1:143351947-143351969 GGTGGAAGGGAGCAGGGGTCTGG - Intergenic
914056951 1:144177532-144177554 GGTGGAAGGGAGCAGGGGTCTGG - Intergenic
914122195 1:144788834-144788856 GGTGGAAGGGAGCAGGGGTCTGG + Intergenic
914972852 1:152326805-152326827 GATTCAAGGCACCAGGGGGCAGG - Intergenic
915343370 1:155188124-155188146 GCTTCAGGGGAGCATGGGGAAGG + Intronic
915362964 1:155296818-155296840 GGTTCAAGGGAGAATGGGGGAGG - Intronic
915440677 1:155943565-155943587 GATTAAAGAGGGGAGGGGGCTGG + Intergenic
915498193 1:156295577-156295599 AGTCCAAAGGAGCAGGGGGCTGG + Exonic
915726242 1:158019662-158019684 TCTTCCAGGGAGCACGGGGCAGG + Intronic
916177761 1:162056641-162056663 GATGGCTGGGAGCAGGGGGCAGG + Intergenic
916915196 1:169399222-169399244 GAGGCAAGGTAGAAGGGGGCTGG + Intronic
917613208 1:176710976-176710998 ATTTCAAGGAAGGAGGGGGCAGG + Intronic
919904554 1:202069234-202069256 GATTAAAAAGTGCAGGGGGCTGG + Intergenic
920102307 1:203525014-203525036 GAGGCAGGGGTGCAGGGGGCAGG - Intergenic
920536065 1:206737314-206737336 TATTCAAGGGAGGAGGGTGAGGG + Intergenic
920821069 1:209381441-209381463 AACTCAAGAGAGCAGAGGGCTGG + Intergenic
920823717 1:209404793-209404815 GATTCCAGGGAGGCGTGGGCAGG - Intergenic
921052455 1:211520626-211520648 TAGTCAAGGGATCAGAGGGCAGG + Intergenic
922224865 1:223637421-223637443 GAATCAGGGGAGCAGGTGACAGG - Intronic
923698974 1:236282002-236282024 GAGCCAAGCGAGCCGGGGGCGGG - Intergenic
923906530 1:238391472-238391494 GATTCAGCTGAGCAGGAGGCTGG + Intergenic
924251462 1:242137334-242137356 GTTGCAAGGAAGCAGTGGGCAGG - Intronic
1062771510 10:104973-104995 GATCCAAGGCGACAGGGGGCTGG + Intergenic
1062869227 10:885108-885130 GCTTCAAGGGAGAAGGGGCAAGG - Intronic
1065056925 10:21854692-21854714 GATTCAAGGCAGAAGAGAGCAGG + Intronic
1066649213 10:37639423-37639445 GTTTCAAGGGAGGAGGGGGCAGG - Intergenic
1069700929 10:70425222-70425244 GATTCCAGAGATCATGGGGCAGG + Exonic
1070290355 10:75109789-75109811 GATTCATGGGGGGAGGGGGAAGG + Intronic
1070712651 10:78693929-78693951 GAGTCAGGGGAGAAGGAGGCTGG + Intergenic
1071259113 10:83903502-83903524 CATTAAAGGTTGCAGGGGGCAGG - Intergenic
1073012673 10:100373528-100373550 GATTCACAGGAGCAAGAGGCTGG - Intergenic
1074496891 10:113987266-113987288 GAGTCAAGGGAGCAAGGGGGAGG + Intergenic
1075023769 10:118968967-118968989 GATTCCAGGGAGCAAGCGTCTGG - Intergenic
1075305744 10:121365811-121365833 GAGCCAAAGGAGCAGGGGGTGGG - Intergenic
1075600612 10:123765873-123765895 GATTCAAGGGAGCTGGAGACAGG - Intronic
1076460147 10:130637542-130637564 TATTCAAGGCAGCAGGTTGCTGG - Intergenic
1076713957 10:132353975-132353997 GAGTCAAGGGGGCAGGTGTCTGG - Intronic
1077242788 11:1519469-1519491 GCTACAGGGGAGCAGGAGGCTGG + Intergenic
1077308549 11:1878470-1878492 GATTCGGGGGCGCGGGGGGCGGG + Intronic
1077537450 11:3131288-3131310 GATACAAGGGAGCGGGAGACTGG - Intronic
1078512735 11:11997662-11997684 CATTCAAGGGAGCCTGGGGGTGG - Intronic
1079368061 11:19826753-19826775 GATTAAAAAGAGCAGGGAGCAGG - Intronic
1080051756 11:27865248-27865270 TAATCAAGGCAGCAAGGGGCAGG + Intergenic
1080149654 11:29036028-29036050 GATTTAAAGGAGGAAGGGGCAGG + Intergenic
1081420949 11:42874239-42874261 GGTGCCATGGAGCAGGGGGCGGG - Intergenic
1081811744 11:45918034-45918056 GACTTGAGGGAGTAGGGGGCCGG - Intronic
1083712768 11:64559258-64559280 GTTTTGAGGGAGCTGGGGGCTGG - Intronic
1084603526 11:70160154-70160176 CATGCAAGGGTGCAGAGGGCAGG - Intronic
1085037301 11:73308231-73308253 GAGGCAAGGGGGCGGGGGGCGGG - Intergenic
1085334295 11:75679139-75679161 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
1085504884 11:77052712-77052734 GATTCCAGGTGGCAGGGAGCTGG + Intergenic
1085639005 11:78179560-78179582 GATGTAGGGGTGCAGGGGGCAGG - Intronic
1086608211 11:88723028-88723050 GTTTCAAGGGAGGAGGGAGCAGG - Intronic
1087582481 11:100075705-100075727 AATTCAAGGGAGAAGGGAGAAGG + Intronic
1088651065 11:111958500-111958522 GAGCTAAGGCAGCAGGGGGCTGG - Intronic
1088906321 11:114157891-114157913 GATTCAGTGGAGCCAGGGGCAGG - Intronic
1089279997 11:117367164-117367186 GAGACAAGGGGGCAGGGGCCAGG + Intronic
1089345262 11:117786921-117786943 TCTTCAGGGGAGCAGGGGGCAGG + Intronic
1089579326 11:119471518-119471540 GATCAGAGGCAGCAGGGGGCCGG + Intergenic
1089679082 11:120109505-120109527 GAGACAAGGGAGCATGGGCCAGG + Intergenic
1089733187 11:120532293-120532315 GATCAAAGGAAGCTGGGGGCGGG - Intronic
1090640632 11:128726343-128726365 AATCCAGGGGTGCAGGGGGCTGG + Intronic
1090718666 11:129452972-129452994 GATTCAGGGGAGGAGAGGGCAGG - Intergenic
1090727024 11:129537489-129537511 TAGTCCAGGGATCAGGGGGCTGG + Intergenic
1091137529 11:133205333-133205355 GATACAGGGGAGCAGCCGGCTGG - Intronic
1091692759 12:2608408-2608430 GATCCCAGGGATCAGGGTGCAGG - Intronic
1092979935 12:13784558-13784580 ATTTCAAGGGGGCAGGGGGGTGG - Intronic
1096748579 12:53744523-53744545 GATCCAAGGGGGCAGGGGAGAGG - Intergenic
1096905537 12:54932068-54932090 GATTCAGATGAGCAGGGGGAGGG + Intergenic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1097285505 12:57874031-57874053 GATTCTAGGGAGCAGGGTAAAGG + Intergenic
1097661809 12:62438304-62438326 AATTCTAGCCAGCAGGGGGCAGG + Intergenic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1099315458 12:81078033-81078055 GAGGGAAGGGAGTAGGGGGCGGG - Exonic
1099991813 12:89730475-89730497 AATTAATGGTAGCAGGGGGCAGG + Intergenic
1101864240 12:108508299-108508321 GATTCAAGGTAGCCAGGGTCTGG - Intergenic
1101903151 12:108806587-108806609 GAGTCAACAGAGCAGGGAGCAGG + Intronic
1101903170 12:108806691-108806713 GACTCAAGGGCCCAGGGGCCTGG - Intronic
1101958718 12:109232254-109232276 GATTACAGGGAGCAGAGGACTGG + Intronic
1102189314 12:110974763-110974785 TATACAAGGGAGGAGGAGGCTGG - Intergenic
1102605032 12:114061790-114061812 GATTCAGACGAGCAGGGGGAGGG - Intergenic
1102641569 12:114371538-114371560 TTTTCATGGGAGCAGGTGGCAGG + Intronic
1102675588 12:114656265-114656287 CAGTCAGGGCAGCAGGGGGCTGG - Intergenic
1103145006 12:118588120-118588142 TATTCAAGAGGGCAGGGAGCAGG - Intergenic
1103557573 12:121775534-121775556 GATTCTGGGGTGCTGGGGGCAGG + Intronic
1103569264 12:121833614-121833636 AATTTGAGGGAGCAGGAGGCTGG + Intergenic
1103620801 12:122186052-122186074 GCTTCCGGGGAGCAGGGGGTGGG + Intronic
1104327542 12:127813396-127813418 CATGAAAGGGAGCAGAGGGCAGG + Intergenic
1104890578 12:132137896-132137918 GATTGAAGGGTGCCGGGGCCGGG - Exonic
1104896798 12:132168733-132168755 GATGCCAGGGAGCAGGATGCGGG + Intergenic
1105770829 13:23610443-23610465 GTCCCAAGGGAGCAGAGGGCTGG - Intronic
1106308842 13:28535326-28535348 GGGCCAAGGAAGCAGGGGGCTGG - Intergenic
1106372858 13:29153486-29153508 GCTTTAAGCGAGGAGGGGGCAGG + Intronic
1107146993 13:37070149-37070171 GGGTCTAGGCAGCAGGGGGCTGG - Intergenic
1108118729 13:47160337-47160359 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
1111014026 13:82353493-82353515 GAGTCAGGGGAGCTGGGAGCTGG - Intergenic
1112090598 13:96079091-96079113 GATTCGAAGAAGCAGGGGTCTGG + Intergenic
1112532059 13:100214534-100214556 GATACCAGGGAGCCGGAGGCAGG - Intronic
1113164989 13:107430438-107430460 GAGTGGAGGGAGCAGGGGGAGGG - Intronic
1113440769 13:110326431-110326453 GACTCAGGGGAGCAGAAGGCTGG - Intronic
1114063017 14:19037612-19037634 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1114099242 14:19362385-19362407 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1114516835 14:23305930-23305952 GATCCAAGAGCCCAGGGGGCTGG + Intronic
1115643053 14:35347574-35347596 GATCAAAGGGAGGAGGGGGTGGG + Intergenic
1115895265 14:38079213-38079235 GAATAAAGGGAGCAGGAAGCAGG - Intergenic
1116313809 14:43360464-43360486 GGGTCAAGGCAGCAGGGGGCTGG + Intergenic
1116902196 14:50371962-50371984 GGTCCGAGGCAGCAGGGGGCTGG - Intronic
1117733960 14:58751092-58751114 CAGCCAAGGCAGCAGGGGGCTGG - Intergenic
1117756669 14:58981606-58981628 GAATCAAGGGGGCAGGGGGAAGG - Intergenic
1117872604 14:60217027-60217049 TATTCAAGGAAGCAGAGTGCGGG + Intergenic
1118200162 14:63663868-63663890 GGGTCAAGGCGGCAGGGGGCTGG + Intergenic
1118501103 14:66363377-66363399 GATTCCTGAGAGCAGGGAGCAGG + Intergenic
1119255200 14:73189786-73189808 GCTTAAGGGGAGCTGGGGGCAGG - Intronic
1119750511 14:77074216-77074238 GGTTCAAGAGAGCAGGGAGGAGG + Intergenic
1121132197 14:91458587-91458609 AATTCAATGGAGCAGGAGGAGGG - Exonic
1121144654 14:91573781-91573803 GCTTGCAGGGAGCAGGAGGCTGG + Intergenic
1121215169 14:92242167-92242189 GATTCAGGTCAGCAGGGGGTGGG - Intergenic
1121234589 14:92383072-92383094 GAGTCAAGCGAGCAGGCAGCCGG - Intronic
1122357156 14:101130130-101130152 GAGACAAGGGAGGAGGTGGCAGG + Intergenic
1122506528 14:102235186-102235208 GAAGCAAGGGAGCAGGCTGCTGG - Intronic
1122885060 14:104707211-104707233 GGGTCAAGGGAGAAGGGAGCCGG - Intronic
1123048684 14:105530475-105530497 GGTTGAGGGGAGCAGGGGCCAGG - Intergenic
1123493528 15:20800572-20800594 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1123550036 15:21369674-21369696 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1125477964 15:40060370-40060392 GATCCCAGGGAGCAGGGGTGAGG - Intergenic
1125827226 15:42686756-42686778 GATTCCAGGGAGCAGAGTGAAGG - Exonic
1125930661 15:43597664-43597686 GATTCATAGGAATAGGGGGCGGG - Intronic
1127525994 15:59792317-59792339 GGGTCAAGGCAGCAGGGGGCTGG + Intergenic
1127863259 15:63011841-63011863 GATGGAAGGGAGCACCGGGCAGG + Intergenic
1128567650 15:68711794-68711816 GATGCACTGGAGAAGGGGGCTGG - Intronic
1128633943 15:69291068-69291090 GACTCCAGGGAGGAGGGGGCTGG - Intergenic
1128943873 15:71808877-71808899 GAGTTAAGGGGACAGGGGGCGGG - Intronic
1130052802 15:80497873-80497895 AATTTAAGGGAGAAGGGGGAAGG + Intronic
1130203398 15:81853819-81853841 GAATCAAGGAAGGAGGGGGCAGG + Intergenic
1130466923 15:84197101-84197123 CATTCCTGGGTGCAGGGGGCTGG + Intergenic
1130497341 15:84476435-84476457 CATTCCTGGGTGCAGGGGGCTGG - Intergenic
1131114274 15:89784489-89784511 GAGGCAAGGGTGCAGGGTGCTGG - Intergenic
1131233346 15:90675371-90675393 GACTCAAGGGAGCAGGGAGCAGG - Intergenic
1131676109 15:94672348-94672370 GCTTCTAGGGAGGAGGGGGTAGG + Intergenic
1202958366 15_KI270727v1_random:96892-96914 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132664839 16:1076624-1076646 GATTCACTGGAGCAGGGTGCTGG - Intergenic
1132671742 16:1104761-1104783 GACTCAAGGGGGCAGGAGGAGGG + Intergenic
1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG + Intergenic
1133896953 16:9938824-9938846 GACTCAAAGGAGGAAGGGGCAGG - Intronic
1133986939 16:10675896-10675918 GATTCACGGGAGAAGGGTGAGGG + Intronic
1134000945 16:10782351-10782373 ATTTCAAAGGAGCAAGGGGCAGG - Intronic
1135138850 16:19904779-19904801 GCTTCAGGGGAGCAGGGTGAAGG + Intergenic
1136145604 16:28314682-28314704 GATTAGAGGGAGAAGGGGCCAGG + Intronic
1136504235 16:30692526-30692548 GATGGAAGAGAGCAGGAGGCAGG + Intergenic
1136616559 16:31401947-31401969 GGAGGAAGGGAGCAGGGGGCTGG + Intronic
1137790393 16:51170132-51170154 CATTGAGGGGAGCAGGTGGCAGG + Intergenic
1141425302 16:83940888-83940910 GGTAGCAGGGAGCAGGGGGCAGG + Intronic
1142304678 16:89278672-89278694 GGTCCAAGGGAGAAGGGGGCGGG + Intronic
1142417670 16:89951727-89951749 CATTCCAGGCAGCAGGAGGCAGG + Intronic
1142718721 17:1762551-1762573 GAGCCGAGGGAGCAGGGGCCAGG - Intronic
1143155541 17:4833802-4833824 GAGAGAAGGGAGCAGAGGGCGGG - Intronic
1143382844 17:6507201-6507223 GCTTCAAGGCGGCAGGAGGCAGG + Intronic
1143659928 17:8318513-8318535 AATGGTAGGGAGCAGGGGGCTGG + Intronic
1144036592 17:11371371-11371393 GAGTCAAGGGAAAAGGGAGCTGG - Intronic
1144202002 17:12949940-12949962 GATTCATTGGAGAAGGGGGTTGG + Intronic
1144310310 17:14007882-14007904 TATTGAAGGGAGCAAGGGACTGG - Intergenic
1144630442 17:16869434-16869456 GCTTCAAGGGAGGTGGGAGCTGG - Intergenic
1145271966 17:21409595-21409617 GACTGATGGGAGCAGGTGGCTGG - Intronic
1145310174 17:21697060-21697082 GACTGATGGGAGCAGGTGGCTGG - Intronic
1146001560 17:29133487-29133509 GAGTCAAGGCAGCAGGGTGGTGG + Intronic
1146272499 17:31493563-31493585 AAAACGAGGGAGCAGGGGGCAGG - Intronic
1146425249 17:32732068-32732090 GGGCCAAGGTAGCAGGGGGCTGG - Intronic
1148060514 17:44832874-44832896 GCTTCAGGGGAGAAAGGGGCGGG - Intergenic
1149944441 17:60906550-60906572 GATTCTAGGAAGCAGGAGGTAGG - Intronic
1150501299 17:65653447-65653469 GATTGAAGGGGGCAGGAGGAGGG + Intronic
1150650735 17:67008440-67008462 AATTGCGGGGAGCAGGGGGCAGG + Intronic
1152204873 17:78969208-78969230 GATGCCAGGGAGCACGGAGCGGG + Intergenic
1153333315 18:3896853-3896875 TCTTCAAGGGAGAAGGGGGAAGG - Intronic
1154396975 18:13999417-13999439 GTTTGAATGGAGCAGAGGGCAGG + Intergenic
1154451061 18:14475035-14475057 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1154507039 18:15051919-15051941 GATACAAGAGAGCAGGAGGATGG - Intergenic
1158602192 18:58864304-58864326 GACGGAAGGGAGGAGGGGGCTGG + Intronic
1158862070 18:61602488-61602510 GCTTCAAGGGAGAAGGGTGAGGG - Intergenic
1159918102 18:74203689-74203711 GCTTCAGGGGAGCTGGGGGAAGG + Intergenic
1160116687 18:76085225-76085247 GTGCCAAGGCAGCAGGGGGCTGG + Intergenic
1160721833 19:600954-600976 GATGCATGGGTGCCGGGGGCCGG - Intronic
1160790503 19:920679-920701 GAAGCCAGGGAGCAGTGGGCTGG + Exonic
1162063621 19:8111463-8111485 TGTTCAAGGGAGCCGTGGGCAGG + Intronic
1163148199 19:15396601-15396623 GAAGGAAGGGAGCCGGGGGCTGG - Intronic
1163559529 19:18010503-18010525 GCTCCAAGGGACCAGGGGCCAGG - Intronic
1164681037 19:30133928-30133950 GAATGAAGTGAGCAGGGAGCTGG + Intergenic
1164968962 19:32513977-32513999 GATTCAATGGGGCAGGGGTGTGG - Intergenic
1165325095 19:35109865-35109887 GATACCAGGGTGCAGGGGGAAGG + Intergenic
1165952618 19:39482741-39482763 GAGTCAAGCCAGGAGGGGGCTGG - Intronic
1166299588 19:41906411-41906433 GAGTCAGGAGACCAGGGGGCTGG - Intronic
1166546167 19:43635895-43635917 GGGTCCAGGGAGGAGGGGGCTGG - Intronic
1166894833 19:46016766-46016788 CAGTCAAGGCAGCAGGGGGCTGG - Exonic
1167253611 19:48414654-48414676 GTCCCAAGGGAGGAGGGGGCTGG - Intronic
1167353807 19:48991686-48991708 GGTCTAAGGGAGAAGGGGGCTGG + Intronic
1167432575 19:49462819-49462841 GGTCCAAGGGAGGAGGGAGCTGG + Intronic
1167795293 19:51704657-51704679 GATCTAAGGGAGGAGGGGGCTGG - Intergenic
1202696434 1_KI270712v1_random:130205-130227 GGTGGAAGGGAGCAGGGGTCTGG - Intergenic
1202704660 1_KI270713v1_random:13966-13988 GATGCAAGAGCCCAGGGGGCTGG - Intergenic
925703188 2:6659356-6659378 GAGTGAAGGGAGCCTGGGGCAGG + Intergenic
926547078 2:14255334-14255356 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
927871654 2:26627947-26627969 GATACCAGGGAGGAGGAGGCTGG - Intronic
928274237 2:29884938-29884960 GATTCAAGGGAGGAAGGGATAGG + Intronic
929369564 2:41206161-41206183 GAGTCAAGGGAGCAAGGAGCAGG + Intergenic
929938821 2:46314961-46314983 GATGCCAGGGAGAAGGAGGCAGG + Intronic
930186073 2:48413420-48413442 TATGCAAGGGAGCAGAGGGAAGG - Intergenic
932522379 2:72427548-72427570 GGGCCAAGGCAGCAGGGGGCTGG - Intronic
932572615 2:72945920-72945942 GATGCGTGGGAGCAGGGGGTGGG - Intronic
932703117 2:74004113-74004135 GCTGGAAGGGAGCATGGGGCAGG + Intronic
933606575 2:84390015-84390037 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
933726445 2:85430163-85430185 GAGTCAAGGGTGCAGGGGACAGG + Intronic
935145995 2:100395844-100395866 GATTTCAGGGAGGAGGGGGAGGG + Intronic
935760859 2:106319422-106319444 GTTTCAGGGGAGAAGGGGCCAGG - Intergenic
937529920 2:122815754-122815776 CATTCAAGGGACCAGGAAGCTGG + Intergenic
938711909 2:133982352-133982374 GAGTCAAGGGCGCAGGGGGGAGG - Intergenic
941432278 2:165427031-165427053 GGGACAAGGCAGCAGGGGGCTGG - Intergenic
941863881 2:170313588-170313610 GATTCTAGGGTCCAGGTGGCTGG - Intronic
941876341 2:170437370-170437392 GCTTCAAGGGAGAAGGGGGTGGG - Intronic
942076329 2:172359904-172359926 CATTCTAGGGAGCAGGGGTTAGG + Intergenic
942413785 2:175737441-175737463 GATTCAGGGGACCCGAGGGCAGG - Intergenic
943644632 2:190396676-190396698 GCTGCAAGGGAGAAGGGAGCTGG + Intergenic
945905417 2:215587548-215587570 GTTTTATGGGGGCAGGGGGCAGG + Intergenic
946166726 2:217869073-217869095 GCTTCAAGGGATCTGGGGTCTGG - Intronic
946281817 2:218671532-218671554 GATCCAAGGGGAAAGGGGGCCGG + Intronic
946669642 2:222089145-222089167 GCTTCAAGGTGGCATGGGGCAGG - Intergenic
946689884 2:222301881-222301903 GGTTCAAGGATGCAGGGCGCGGG - Intronic
948171446 2:235906580-235906602 GACTCAAGGGAAAAGGGTGCAGG - Intronic
948977835 2:241474492-241474514 GAAACAAGGGAGAAGGTGGCCGG + Intronic
1168757668 20:327418-327440 GCTTCTGGGGAGGAGGGGGCTGG + Exonic
1169680271 20:8204201-8204223 GTGTCAAGGGAGCAGAGGGATGG + Intronic
1170327794 20:15176114-15176136 GGGCCAAGGCAGCAGGGGGCTGG - Intronic
1171161081 20:22924413-22924435 GATAAAAGGGAGCAGGAGGTAGG + Intergenic
1171438404 20:25141515-25141537 CACTCCAGGGGGCAGGGGGCAGG + Intergenic
1172627769 20:36358019-36358041 GATTCAGGGGAGCACTGGACAGG + Intronic
1173416157 20:42857977-42857999 GATTCATGAGAGCAAGGAGCTGG + Intronic
1174266431 20:49335547-49335569 CATTCCAGGGAGCTGCGGGCAGG + Intergenic
1175974125 20:62701891-62701913 GATGCCAGGGTGCAGGGAGCCGG + Intergenic
1176429921 21:6569272-6569294 GATTGAAAGGAACTGGGGGCTGG - Intergenic
1176445173 21:6815538-6815560 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1176790835 21:13317178-13317200 GATACAAGAGAGCAGGAGGGTGG + Intergenic
1176823340 21:13680571-13680593 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1177990956 21:28036190-28036212 GATACAAGAGAGCAGGAGGGTGG - Intergenic
1178561219 21:33641748-33641770 GACCAATGGGAGCAGGGGGCGGG - Exonic
1179705315 21:43176734-43176756 GATTGAAAGGAACTGGGGGCTGG - Intergenic
1180233945 21:46445444-46445466 AATTCAAGGCATCTGGGGGCTGG - Exonic
1180481510 22:15760239-15760261 TAGTCCGGGGAGCAGGGGGCAGG + Intergenic
1181488272 22:23245237-23245259 GAGTCAAGGCATCAGGGAGCAGG + Intronic
1182285585 22:29245141-29245163 GATTCAGGACAGCAGGGGCCAGG - Intronic
1183492442 22:38123710-38123732 GAAGCAGGGGAGGAGGGGGCAGG + Intronic
1184083513 22:42243033-42243055 GATCCAAGGGAAGAGGGGGAAGG + Intronic
1184535289 22:45082466-45082488 GATTCCAGGGATGAGGGGGCGGG + Intergenic
1184567293 22:45299598-45299620 GGATGCAGGGAGCAGGGGGCAGG + Intergenic
1184927591 22:47654170-47654192 CATTCAAGAGAGCAGTGAGCTGG + Intergenic
1185072194 22:48662490-48662512 GATTCAAGGGCCCAGGCGGTGGG + Intronic
1185292815 22:50035635-50035657 GCTTCAGGGGCGCGGGGGGCTGG - Intronic
950161628 3:10764838-10764860 AACTCCAGGGAGCAGGGGCCAGG - Intergenic
950863861 3:16173732-16173754 GAGGCAAGGGGGCGGGGGGCAGG - Intergenic
952297551 3:32074586-32074608 GATTCAGATGAGCAGGGGGAGGG - Intronic
953754196 3:45632535-45632557 GATACAAGGAAGCAGGTGCCAGG + Intronic
954700095 3:52446453-52446475 GAGTGAAGGGAGCTGGGGACAGG - Intergenic
955225495 3:57056959-57056981 GATGGAAGGGGGCAGGGGGCAGG - Intronic
955719773 3:61868427-61868449 GAGGCCAGGGAGCTGGGGGCAGG - Intronic
958782548 3:98560102-98560124 GTGTCATGGGAGCAGGGGGAGGG + Intronic
960141108 3:114152712-114152734 GGTTCCAGGAAGCAGGGCGCCGG - Intronic
960634300 3:119768342-119768364 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
961260164 3:125595567-125595589 GCGGGAAGGGAGCAGGGGGCGGG - Intergenic
961557708 3:127708000-127708022 GAATCGAGGGTGCAGGGGCCTGG - Intronic
961674759 3:128557949-128557971 GCACCAAGGGAGCAGAGGGCTGG + Intergenic
961862977 3:129932506-129932528 GAGTCAATGGAGCAAGGGCCAGG - Intergenic
961909618 3:130301252-130301274 GATTCAAGAGGGGTGGGGGCTGG + Intergenic
962763893 3:138543329-138543351 GAACCAAGGCAGTAGGGGGCTGG + Intronic
963605491 3:147409317-147409339 GATGAATGGGAGCAGGGGGGAGG - Intronic
964911611 3:161789598-161789620 GCTTCAAGGGAGGAGGGTGAGGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966624816 3:182004650-182004672 GATTCATGGGGGAAGGGGGTAGG - Intergenic
968351939 3:198064950-198064972 GATTAAAGGAGGCAGAGGGCAGG + Intergenic
968412357 4:401168-401190 GATTCAGATGAGCAGGGGGAGGG + Intergenic
968468591 4:765724-765746 GGTTTGAGGGAGAAGGGGGCAGG + Intronic
968584357 4:1409231-1409253 GGTTCAGAGGAGCAGGGGCCGGG + Intergenic
969179173 4:5424150-5424172 GGGCCAAGGTAGCAGGGGGCTGG - Intronic
969310136 4:6348213-6348235 GCTTCATGGGAACAGGGGACAGG - Intronic
969344439 4:6562455-6562477 GATTCAACGGAGTCGGGGGGGGG + Intronic
969671660 4:8593234-8593256 GGTTCGAGGGAGCAGGTGCCAGG + Intronic
970381752 4:15515284-15515306 GCTCCAAGGCAGCAGGGGCCTGG + Intronic
970918109 4:21359258-21359280 GAACCAGGGGAGCAGAGGGCAGG - Intronic
970959590 4:21856893-21856915 AGTCCAAGGCAGCAGGGGGCTGG - Intronic
971876897 4:32319115-32319137 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
972075204 4:35079034-35079056 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
973613119 4:52656446-52656468 GATTGACCTGAGCAGGGGGCGGG + Intronic
975684809 4:76909216-76909238 GACTCAAGGGAGAAGGGGAGGGG - Intergenic
976273402 4:83252213-83252235 TCTTCTAGGGAGCAGGGGGACGG + Intergenic
976647286 4:87399700-87399722 GAGCCAAGGTGGCAGGGGGCTGG - Intergenic
976734530 4:88296561-88296583 GGGCCAAGGTAGCAGGGGGCTGG + Intergenic
976987861 4:91325388-91325410 GATGAAAGGGAGCAAGGGGTAGG + Intronic
978219794 4:106256402-106256424 GAGTCAAGGCAGCAGGGGGCTGG + Intronic
978377269 4:108087958-108087980 GATTAAAGGAAGCAGGGTGGAGG + Intronic
979649028 4:123107788-123107810 GGTTCAAGGTGGCTGGGGGCTGG + Intronic
980671087 4:136008437-136008459 GGGTCAAGGCAGCAGGGGGCCGG - Intergenic
983581607 4:169315076-169315098 AATTCAAGTGAGCATGGCGCTGG - Intergenic
984375278 4:178922065-178922087 AAGCCAAGGCAGCAGGGGGCTGG - Intergenic
984604432 4:181768284-181768306 GATTCTAGTGAGTAGGGGCCCGG + Intergenic
984639311 4:182144646-182144668 AATTCAAAGGAGCCGGGCGCGGG - Intronic
985490092 5:174190-174212 GAGTCCAGGGGCCAGGGGGCTGG + Intronic
985529584 5:426115-426137 GATTCAAGGCAGCGGTGTGCTGG - Intronic
986167015 5:5282478-5282500 GATTTAAGTGAGGAGAGGGCTGG - Intronic
987051528 5:14150323-14150345 GCTACAAGGGGGCAGGAGGCAGG + Intronic
988201732 5:28077701-28077723 GGTGCCATGGAGCAGGGGGCGGG + Intergenic
989425468 5:41290959-41290981 GAGCCAAGGTGGCAGGGGGCTGG + Intergenic
989506193 5:42229831-42229853 GGTTCAAGGGAGTCAGGGGCAGG + Intergenic
990786029 5:59420879-59420901 CAGTCAGGGTAGCAGGGGGCAGG + Intronic
992476223 5:77104123-77104145 GAGTCAAGGGAGCATAGAGCAGG + Intergenic
992776475 5:80093515-80093537 ACTTCCAGGGAGCAGGGGGCAGG + Intergenic
993071453 5:83169032-83169054 AATTCAAGGGAGCTGTGGGTGGG + Intronic
993618092 5:90137117-90137139 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
995742362 5:115368638-115368660 GAGCCAAGGAAGAAGGGGGCTGG - Intergenic
995833251 5:116376514-116376536 GATTCAAGGGAGCAGGGGGCAGG + Intronic
995926955 5:117386207-117386229 GGGCCAAGGTAGCAGGGGGCTGG - Intergenic
997578805 5:135004599-135004621 GCACCAAGGGAGCAGGGGCCAGG + Intronic
1001226112 5:169946003-169946025 GATGCAAGGAAGCAGGGAGGAGG - Intronic
1001241234 5:170071296-170071318 GCTCCAAGTGAGCAGGGAGCAGG - Intronic
1001631305 5:173177622-173177644 GAATCAAGTGGGCAGGGGTCGGG + Intergenic
1002846928 6:955349-955371 GATTCCAGGGAGTAGGATGCGGG - Intergenic
1003383095 6:5642912-5642934 GCTTCAAGGCTGCAGGGGACTGG - Intronic
1004304419 6:14487430-14487452 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
1006398393 6:33801793-33801815 GATGCACTGGAGCACGGGGCGGG - Intronic
1006408361 6:33857902-33857924 GATTCAGGTGTGGAGGGGGCTGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1010371630 6:75116577-75116599 GATGAAAGTGAGTAGGGGGCTGG - Intronic
1012889873 6:104885759-104885781 GCTCCGAGGCAGCAGGGGGCTGG - Intergenic
1013067807 6:106700458-106700480 CATTCAAGGGAGAAGGGCGAGGG - Intergenic
1014550012 6:122779442-122779464 GATTCAATGGGGCTGGAGGCAGG - Intergenic
1015895055 6:138008920-138008942 GTATCAAGGGAGCATGGGGGAGG + Intergenic
1015970084 6:138734882-138734904 GATTCCAGGGAGCAGGAGTGAGG - Intergenic
1017106187 6:150890399-150890421 GGTTCAAGGGAGACAGGGGCAGG + Intronic
1017720634 6:157240958-157240980 GATCCCCGGGAGTAGGGGGCTGG - Intergenic
1017922135 6:158881976-158881998 GATTCAGACGAGCAGGGGGAGGG + Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018036694 6:159888196-159888218 GAGTCAGGAGGGCAGGGGGCTGG - Intergenic
1018046236 6:159969004-159969026 GAGTCACGTGAGCGGGGGGCGGG + Intergenic
1018127494 6:160695793-160695815 GTTGCAAGGCAGCAAGGGGCAGG + Intergenic
1018149028 6:160921259-160921281 GTTGCAAGGGAGCAACGGGCAGG - Intergenic
1019227799 6:170529579-170529601 GAGAGAAGGGAGCAGGGGACTGG - Intergenic
1019569393 7:1703666-1703688 GATTAAAGGAAGCAGGGAGGTGG + Intronic
1022758903 7:33326242-33326264 GATTCAAGGGAGAAGAGGGGAGG - Intronic
1024149022 7:46550063-46550085 GATTCCAGTGAGCAGAGGTCAGG + Intergenic
1024800101 7:53067238-53067260 GATGCAGGGGAGCAGGGGGCAGG + Intergenic
1026617494 7:71918774-71918796 AATTCCAAGGAGCTGGGGGCTGG - Intronic
1028640726 7:93039629-93039651 GGGCCAAGGCAGCAGGGGGCTGG - Intergenic
1029670095 7:102024182-102024204 GATGGAGGAGAGCAGGGGGCTGG - Intronic
1030700357 7:112631619-112631641 GATACATGAGAGCAGGGGCCTGG - Intergenic
1031743785 7:125468381-125468403 GAGCCTAGGTAGCAGGGGGCTGG + Intergenic
1032477827 7:132224389-132224411 GATTCACGGGAGAAGGGCCCAGG - Intronic
1033309099 7:140246859-140246881 CATTCAAGGTACCAGGGGCCAGG + Intergenic
1033315330 7:140292429-140292451 GATTCATGGGGCCAGGGGTCAGG - Intergenic
1033666570 7:143446302-143446324 GATTCATCTGAGCAGGGGACGGG - Intergenic
1034229963 7:149516218-149516240 GCTGCATGGGAGCAGGGTGCAGG - Intergenic
1035310865 7:157967827-157967849 GAATCCAGGGAGAAGGGGTCTGG + Intronic
1035375588 7:158404859-158404881 GAGGCCAGGGAGCTGGGGGCTGG - Intronic
1035375658 7:158405048-158405070 GAGGCCAGGGAGCTGGGGGCCGG - Intronic
1036604017 8:10290573-10290595 GATACAGGAGAGCTGGGGGCAGG - Intronic
1037945544 8:22987392-22987414 GATTCCTGTGACCAGGGGGCCGG - Intronic
1039179855 8:34854399-34854421 GATTCAAGGGAGAAGGGAGAAGG + Intergenic
1040407862 8:47125733-47125755 GATTAAAAGGGGCAGGGGGCAGG + Intergenic
1041100949 8:54396134-54396156 GCTTGGAGGGAGCAGGGGACAGG + Intergenic
1041939593 8:63371812-63371834 GAATAAAGGGAGGAGGGGGGTGG - Intergenic
1042487341 8:69361174-69361196 TATTCAAGGGAGAAGGGAGGAGG - Intergenic
1042625035 8:70748493-70748515 GAGCCAAGGTTGCAGGGGGCTGG - Intronic
1043275359 8:78385683-78385705 GATACAATGGGGCAGGGGGTTGG - Intergenic
1043533094 8:81171858-81171880 GGGCCAAGGCAGCAGGGGGCTGG + Intergenic
1043750375 8:83926664-83926686 GAGTCAAGGCGGCAGGGGGCTGG + Intergenic
1043882729 8:85563606-85563628 AATTCAAGGGAGCGGGCAGCTGG - Intergenic
1045442673 8:102229450-102229472 GATACAACGGAGCAGGGTGGAGG + Intronic
1047322037 8:123795798-123795820 GATTTAAGGCAGGAAGGGGCAGG + Intronic
1049168394 8:141141385-141141407 GAGCCAAGGGACCAGGGGGCTGG + Intronic
1049367721 8:142248802-142248824 GATACAGGGCAGCAGGAGGCTGG - Intronic
1049393189 8:142382497-142382519 GAGTCATGCGGGCAGGGGGCAGG + Intronic
1050358396 9:4804582-4804604 GGTTGAAGGGAGCTGTGGGCGGG + Intronic
1050941913 9:11471421-11471443 GGGTCAAGGTGGCAGGGGGCTGG - Intergenic
1053304082 9:36971717-36971739 GCTTCAGGGGAGCAAGGGGCAGG + Intronic
1057150797 9:92794265-92794287 GATTAAAGGGAGCAAGGGGTGGG + Intergenic
1057884766 9:98821946-98821968 GCTGCATGGGAGCAGGGGCCTGG + Intronic
1058091854 9:100814179-100814201 GAGCCAAGGCAGCAGGGGGCAGG - Intergenic
1059058821 9:111014018-111014040 GAATGGAGGGAGCAGGAGGCTGG - Intronic
1059141534 9:111857581-111857603 GATCCCAGGGAGCAAGAGGCAGG - Intergenic
1060599702 9:124869590-124869612 GACTCAAGGGAGCACGGCCCAGG - Intronic
1061612233 9:131754774-131754796 GATTTAAGGGACCAGGGTTCTGG - Intergenic
1061798227 9:133100797-133100819 GGGTCAAGGTAGCAGGGGCCTGG - Intronic
1062054465 9:134463726-134463748 GCTCCAAGGGGGCAGGGGGATGG - Intergenic
1062407386 9:136403340-136403362 GGTTCCAGGGAGCAAGGGGTGGG + Intronic
1062459095 9:136655411-136655433 GATGCAGGGGTGCAGGGTGCTGG + Intergenic
1203524022 Un_GL000213v1:68987-69009 TAGTCCGGGGAGCAGGGGGCAGG - Intergenic
1186126274 X:6417931-6417953 GATTCAAGGGAGCACTTGTCTGG + Intergenic
1186440360 X:9580695-9580717 GAAGCAAGGGTGCAGGGGGAAGG + Intronic
1186456337 X:9712959-9712981 GATGAAAGGGGGCAGGGGGAAGG - Intronic
1186735913 X:12463760-12463782 GATTCCAGGAAGCAGGGGTAAGG + Intronic
1187010150 X:15270269-15270291 GAGTGAAGGGAGCAGGGTGGGGG + Intronic
1187189585 X:17020929-17020951 GATTCAAAGCAGCAGGCGGCCGG - Intronic
1187272023 X:17788230-17788252 GACTCAGGGGAGCTGGGGGACGG - Intergenic
1187391937 X:18891756-18891778 GACCCAAGGGGGCAGGGGCCTGG + Intergenic
1188567596 X:31544431-31544453 GCTTCAGGGGAGAAGGGGGAAGG - Intronic
1188647810 X:32591978-32592000 GGCGCAAGGCAGCAGGGGGCTGG - Intronic
1189172379 X:38922227-38922249 GATCCCAGGGAGCAGGGAGATGG + Intergenic
1190043633 X:47093700-47093722 GTTTCCTGGGAGCAGGGGACAGG - Intergenic
1190063970 X:47227838-47227860 GATGCAAGGGAGCTGGGGGTGGG - Intronic
1190284148 X:48951050-48951072 GAATTAAGGCAGCAGGGGCCTGG + Intronic
1190736082 X:53256646-53256668 GAGTCCAGGCACCAGGGGGCAGG - Intronic
1191883318 X:65863784-65863806 GATACAAGGGGGCAAAGGGCAGG - Intergenic
1192350299 X:70350395-70350417 GAATCACGGGAGCCGGAGGCAGG + Intronic
1192581872 X:72289873-72289895 AATTTAAAGGAGGAGGGGGCCGG - Intronic
1195219448 X:102732327-102732349 GATCCAAGGGAGTCAGGGGCAGG + Intronic
1197166075 X:123379144-123379166 GATTCAGGGGAGAAGTTGGCTGG - Intronic
1197362511 X:125523143-125523165 GATTGAAGAGAGCAGGGGAATGG - Intergenic
1197882210 X:131178567-131178589 GTATGAATGGAGCAGGGGGCAGG + Intergenic
1198868450 X:141150938-141150960 GATTCAAGGGAAGAGGATGCTGG - Intergenic
1199897457 X:152138065-152138087 GCTTCAGGGGAGCAGAGGGAAGG - Intronic
1199934262 X:152555791-152555813 GAATCAGGAGAGCAGGGTGCAGG + Intergenic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1201982388 Y:19922216-19922238 AATTCAAGGGTGCAGTGGCCTGG + Intergenic