ID: 995833293

View in Genome Browser
Species Human (GRCh38)
Location 5:116376897-116376919
Sequence CTGTGTGGGTGGGGTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1469
Summary {0: 1, 1: 0, 2: 12, 3: 153, 4: 1303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995833286_995833293 -9 Left 995833286 5:116376883-116376905 CCTGATCCAATGAGCTGTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG 0: 1
1: 0
2: 12
3: 153
4: 1303
995833284_995833293 -8 Left 995833284 5:116376882-116376904 CCCTGATCCAATGAGCTGTGTGG 0: 1
1: 0
2: 1
3: 10
4: 123
Right 995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG 0: 1
1: 0
2: 12
3: 153
4: 1303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995833293 Original CRISPR CTGTGTGGGTGGGGTGTGGA TGG Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900148154 1:1167245-1167267 CTGTGTGGGAGGGGAGTGTGGGG - Intergenic
900237106 1:1598138-1598160 CGGGGTGGCTGGGGTGAGGATGG + Exonic
900325081 1:2104655-2104677 CAGTGTGGGTGGGGACTGGGAGG + Intronic
900330921 1:2133997-2134019 CCAGGTGGGTGGAGTGTGGAGGG + Intronic
900337117 1:2169757-2169779 GTGGCTGGGTGGGGTGTGCACGG + Intronic
900432373 1:2608414-2608436 ATGTGTGTGTGTGGTGTGGGGGG - Intronic
900436808 1:2634846-2634868 CTGTGTGGGTGTTGGGGGGATGG - Intergenic
900760114 1:4464626-4464648 CTGTGAAGGTGAGGTGAGGAGGG + Intergenic
900795846 1:4707937-4707959 CTCTGTGGGTGTGATGTGGGCGG + Intronic
900987309 1:6080651-6080673 GTTTGTGGGTGGGGGGTGTATGG - Intronic
901056539 1:6451070-6451092 GTCTGTGGGTGTGGTGGGGAGGG + Intronic
901312069 1:8277075-8277097 ATGTGTGTGTGGTGTGTGTATGG - Intergenic
901360734 1:8697373-8697395 TTGTGTGGGGGGGGTGTGGTTGG - Intronic
901417992 1:9129865-9129887 CTGTGTGTGTTGTGAGTGGAAGG + Intergenic
901633579 1:10659394-10659416 GTGTGTGGGTGGCGTGTGTGGGG + Intronic
901745959 1:11373609-11373631 GTGTATGGGTGTGGTGTGTATGG + Intergenic
901745962 1:11373634-11373656 GTGTGTGTGTGGTGTGTGGATGG + Intergenic
901746037 1:11374355-11374377 TGGTGTGTGTGGTGTGTGGATGG + Intergenic
901799278 1:11698061-11698083 CTGTGTGGTTTGTGTGTGGGTGG - Intronic
902301276 1:15504565-15504587 CTGGGTGGGTCTGGTGGGGAGGG - Intronic
902355989 1:15900870-15900892 CAGTGGGGGTGGGGTGGGGTAGG - Intronic
902596990 1:17516354-17516376 GGGTGTGGGTGGGGTGAAGAGGG + Intergenic
902708529 1:18223004-18223026 CTCTCTGGCTGGGGTGAGGAGGG - Intronic
902886727 1:19410478-19410500 GTGTATGGGTGGGGGGTGGTGGG + Intronic
903295881 1:22342873-22342895 CTGGCTGGGTCAGGTGTGGAGGG - Intergenic
903489228 1:23715313-23715335 CTGGGAGGGTGGTGTGTCGAGGG - Intergenic
903756843 1:25668236-25668258 CTGAGTGGGTGGGGTGGCCAAGG - Intronic
903818064 1:26079547-26079569 CTGTGGGGGTGGGGAGCGGCAGG - Intergenic
903969073 1:27107382-27107404 GTGTGTGTGTAGTGTGTGGAGGG - Intronic
904011605 1:27393217-27393239 CTGGGAGGGTGGGGGGTGGGGGG + Intronic
904115734 1:28160556-28160578 GTGTGTGTGTGGGGGGTGGCGGG - Intronic
904392378 1:30194626-30194648 GTGTGTGTCTGGGGTGGGGAGGG + Intergenic
904471042 1:30736370-30736392 CTCTCTGTGTGGGGTGTGGATGG + Intronic
904592300 1:31621628-31621650 CTGTGTGGGCTGGGGGTGGGAGG + Intronic
905065875 1:35182158-35182180 GTGTGTGGGTGGGGGCTGGTCGG - Intronic
905212427 1:36383930-36383952 CCTTGGGGGTGGGGTGGGGACGG - Intronic
905233671 1:36530749-36530771 GTGTGTGTGTGTGGTGTGGTGGG + Intergenic
905249095 1:36636589-36636611 CTGTGTGTGTCGGGTGGGAATGG + Intergenic
905461526 1:38125906-38125928 CTGAGAGGGTGGAGTGTGGGAGG + Intergenic
905720920 1:40201044-40201066 GTGTGTGTGTGAGGTGTGGGGGG - Intronic
905892962 1:41528552-41528574 GTGTGAGGGTGGGGTGTGTGAGG - Intronic
905892967 1:41528567-41528589 GTGTGAGGGTGGGGTGTGTGAGG - Intronic
905892972 1:41528582-41528604 GTGTGAGGGTGGGGTGTGTGAGG - Intronic
905893160 1:41529551-41529573 GTGTGAGGGTGGGGTGTGGGGGG - Intronic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906213403 1:44024736-44024758 CTGCCTGGCTGGGGTGAGGATGG - Intronic
906548822 1:46643791-46643813 CTGGGTTGGTGGGGGGTGAAGGG + Intronic
906678054 1:47707845-47707867 CGATGTGAGTGGGGTGGGGACGG + Intergenic
906684074 1:47751725-47751747 CTGGGTGGGTGGGGAGGGGTAGG + Intergenic
907052812 1:51341179-51341201 GTGTGTGGGCGGGGGGTGGGGGG - Intronic
907268721 1:53277910-53277932 GTGAGTGGGTGTGGAGTGGATGG + Intronic
907400387 1:54221673-54221695 CTGAGTGTGTGGTGTGTGGGTGG - Intronic
907637223 1:56147643-56147665 GTGTGTGGGTGGGGTGGAGGGGG + Intergenic
907731235 1:57068045-57068067 CAGTGGGGGCGGGGTGGGGAGGG - Intronic
907744155 1:57196017-57196039 CTGTGAGGATGGGGTGGTGATGG + Intronic
907850054 1:58247782-58247804 AGGTGGGGGTGGGGTGGGGAGGG - Intronic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908325999 1:63024352-63024374 GTGTGTGGGGAGGGAGTGGAGGG + Intergenic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909463690 1:75948332-75948354 ATGTGTGGGTGGAGTGGAGAGGG + Intergenic
909475864 1:76080149-76080171 GTATATGGGTGGGGTGTTGACGG + Intronic
909636470 1:77822030-77822052 ATGTGTGTGTGTGGTGTGTAAGG - Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910147105 1:84093305-84093327 CTGTGTGTGTGTGGTGAGGTAGG + Intronic
910415895 1:86997746-86997768 CTGTGTGGGTGGGGAGGGAAGGG + Intronic
911266427 1:95750086-95750108 CTGTGTGTGTGTGGTGGGGTGGG - Intergenic
911366521 1:96945585-96945607 TTGAGTCAGTGGGGTGTGGAAGG - Intergenic
912330619 1:108817266-108817288 CTGTGTGGTTTGGGTGTGGGTGG + Intronic
912700291 1:111873223-111873245 CTGTGTGCATTGTGTGTGGAGGG + Intronic
913009732 1:114670778-114670800 CTGGCTGGGTGGGGTGGGGTGGG - Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913240595 1:116826298-116826320 CTGGGTGTGTGGGGTGTGTGAGG - Intergenic
913241679 1:116835327-116835349 GTGTGTGTCTGGGGTGCGGAGGG + Intergenic
913611401 1:120512839-120512861 GAGTGTAGGTGGGGTGTAGATGG + Intergenic
914447889 1:147765511-147765533 CTGTAGGGGTGTGGAGTGGATGG + Intronic
914579791 1:149009400-149009422 GAGTGTAGGTGGGGTGTAGATGG - Intronic
914916855 1:151824293-151824315 CTGTGTGTGTGTGGTGGGGGTGG + Intronic
914925095 1:151878283-151878305 CTATGTGTGTGTGGAGTGGAGGG - Intronic
915127772 1:153678246-153678268 GTGTTTGGGTGTGGGGTGGAAGG - Intergenic
915265591 1:154714568-154714590 GTGTGTGTGTGTGGTGTGTATGG + Intronic
915325088 1:155077800-155077822 GTGTGTGTGTTGTGTGTGGATGG + Intergenic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915532672 1:156512134-156512156 GCGTGGGGGTGGGGGGTGGAAGG + Intergenic
915921295 1:159977762-159977784 CTGTCTGGCTGAGGTGTAGATGG - Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916237689 1:162607049-162607071 GTGGGTGGGTGGGGTGTAGAGGG - Intergenic
916830425 1:168485376-168485398 CTGGGTTGGTGGGGTGGGGGTGG + Intergenic
916854702 1:168737570-168737592 CTGTGTGGGTGGTGTGTGACAGG - Intergenic
916962688 1:169905137-169905159 GTGTGTATGTGGGGTGAGGAAGG - Intergenic
917137688 1:171803304-171803326 GTGTGTGTGTGGGGTGGGGTGGG + Intronic
917250814 1:173058668-173058690 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
917562008 1:176168399-176168421 CTGGGTGGGTGGGGGGAGTACGG + Intronic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
919027332 1:192192581-192192603 CAGTGGGGGTGGGGTAGGGATGG + Intergenic
919464067 1:197911034-197911056 CAGTGGGGGGGGGGTGTGGGGGG - Intergenic
919850851 1:201671384-201671406 ATGTGTAGGTGGGGTGGGGCAGG - Intronic
920060778 1:203225627-203225649 CAGGGTGGGTGGGATGTGGTGGG - Intronic
920109238 1:203575463-203575485 GAGTGAGGGTGGGGTGAGGATGG - Intergenic
920189115 1:204181065-204181087 GTGTGTGTGTGTGGTGTGTAGGG + Intergenic
920514579 1:206575213-206575235 CCGGGTGTTTGGGGTGTGGAAGG + Intronic
920650697 1:207835257-207835279 CTGTGTGGGTGGGCAGGGAAGGG - Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
921053440 1:211527032-211527054 CTGTCTGGGTGGGGGCTGCAGGG - Intergenic
921249226 1:213281019-213281041 GTGTGTGGGTGGGGAGGGGAGGG - Intergenic
921292547 1:213672003-213672025 CTGTGTGGGTAGGGTTGGGGTGG - Intergenic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922618911 1:226978919-226978941 GTGTGTGGTGGGTGTGTGGAGGG - Intronic
922856851 1:228782928-228782950 GTGTGTGGGTGTGGTGTGTGGGG + Intergenic
923637407 1:235713601-235713623 CTGGGGGGATGGGGTGTGGGTGG + Intronic
923665265 1:235993397-235993419 GTGTGTGTGTTGGGTGGGGAAGG + Intronic
923800361 1:237203153-237203175 GTGGGTGGGTGGGGTGTGTGTGG - Intronic
924218012 1:241845391-241845413 ATGTGTGTGTGTGGTGGGGAAGG + Intergenic
924332372 1:242953146-242953168 GTGTGTGGGTAGGGTGTGTGGGG - Intergenic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1062831360 10:608172-608194 CTGTGTGTGTGGGGTGTGTGTGG - Intronic
1062917675 10:1254202-1254224 CTCTGTGGTTAGGATGTGGAGGG + Intronic
1062956031 10:1541147-1541169 GAGTGTGAGTGGGGTCTGGACGG - Intronic
1062956207 10:1542051-1542073 GAGTGTGAGTGGGGTCTGGACGG - Intronic
1063031284 10:2237894-2237916 CTGCCTGGCTGGGGTGTGGGGGG + Intergenic
1063303147 10:4871696-4871718 TTGTGGGGGTGGGGTGGGGGCGG + Intergenic
1063378502 10:5569327-5569349 GTGTGTGGTTGGTGTGTGGTTGG + Intergenic
1064710713 10:18121519-18121541 GTGTGTGTGTGGTGTGTGGTTGG + Intergenic
1065028064 10:21557755-21557777 CTCTGTGGCTGGAGTGGGGAGGG + Intronic
1065661695 10:28010153-28010175 GTGTGTGGGTAGAGTGGGGAAGG + Intergenic
1065916578 10:30358455-30358477 CAGTGTGTGTAGGGTGTGGAGGG + Intronic
1065952797 10:30667311-30667333 CTGGCTGGGTGGGATATGGAAGG - Intergenic
1066087946 10:31989300-31989322 CACTGTGGGTGGGGAGTGGGTGG + Intergenic
1066468268 10:35672047-35672069 ATGTGGGGGCGGGGGGTGGATGG + Intergenic
1066495646 10:35939262-35939284 CAGTGAGAGTGGGGTGTGGCAGG - Intergenic
1066646671 10:37617681-37617703 CAGTGAGAGTGGGGTGTGGCAGG + Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067040462 10:42950748-42950770 ATGTGTGTGTGGGGTGGGGGCGG - Intergenic
1067044934 10:42980226-42980248 CTGTGTGGGAGGGGAGGTGAGGG - Intergenic
1067211252 10:44261781-44261803 CTGGGTGAGTGAGGTGTGCAAGG - Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067414498 10:46093164-46093186 TTGTGTGTGTGGGGTGTGCTGGG - Intergenic
1067421471 10:46154510-46154532 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067434560 10:46267706-46267728 TTGTGTGTGTGGGGTGTGCTGGG - Intergenic
1067506808 10:46860961-46860983 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067562180 10:47311822-47311844 TTGTGTGGGTGTGGTGGGAAGGG - Intronic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067827950 10:49592963-49592985 CTGTTGGGGTGGGGTGAGGCAGG + Intergenic
1067833695 10:49624892-49624914 ATGAGTGGGTGGTGGGTGGAAGG + Intronic
1067915792 10:50396755-50396777 ACTTGTGGGTGGGGTGGGGATGG - Intronic
1067927529 10:50525386-50525408 CTGTCTGGGTGGCATTTGGAAGG - Intronic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1067974705 10:51011203-51011225 GTGTGTGGGTGGGGAGGGGGCGG + Intronic
1068201726 10:53791920-53791942 CTTTGTGTGTGGGGTGGGGTGGG - Intergenic
1069508575 10:69023130-69023152 GTGCATGGGTGGGGTGTTGAAGG - Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069832610 10:71290414-71290436 CTCTGAGGGTGGGAAGTGGAGGG - Intronic
1069852837 10:71421362-71421384 CTGTGTGCCTGGGGAGTGGGTGG + Intronic
1070262898 10:74874794-74874816 GTGTGTGGGTGGTGTGTGTGGGG + Intronic
1070534122 10:77362354-77362376 GTGTGTGTGTGGGGTGGGGGGGG - Intronic
1070601403 10:77868835-77868857 CTTTGGGGTTGGGGTGGGGATGG + Intronic
1070630206 10:78079344-78079366 GTGTGGGGGTGGGGAGTGGGTGG + Intergenic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071495052 10:86162398-86162420 CTGTGTGGCTGGGCTTTGGGTGG - Intronic
1072658245 10:97345728-97345750 GTGAGTGGGAGGGGTGTGGTAGG - Intergenic
1072766022 10:98095879-98095901 GTTTGTGAGTGAGGTGTGGAAGG + Intergenic
1073051212 10:100668563-100668585 GTGTGTGGTGGGGGTGTGGGGGG - Intergenic
1073144817 10:101273590-101273612 GTGTGTGGTTGGGGAGTGGCAGG - Intergenic
1073302220 10:102477851-102477873 GTGTGTGTGTGGGGTGGGGTGGG - Intergenic
1073330760 10:102668724-102668746 CTGTGGGCGTGGGTTGGGGAGGG + Intergenic
1073421050 10:103423916-103423938 CTGTGTGGGTAGGGAGTGGCTGG + Intronic
1073426728 10:103459547-103459569 GTGTGTTTGTGGGCTGTGGATGG + Intergenic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1073888578 10:108070234-108070256 TTGTGAGGGTGGGGTATTGAAGG + Intergenic
1074157591 10:110812213-110812235 GTGTGTGGGTGGGGTGGGATGGG + Intronic
1074220903 10:111436742-111436764 ATATGTGTGTTGGGTGTGGAGGG - Intergenic
1074252460 10:111765173-111765195 ATGTGTGTGTGGGGGGTGGGGGG - Intergenic
1074367485 10:112870989-112871011 CTCTGGGGGTGTGTTGTGGAAGG - Intergenic
1074497804 10:113995305-113995327 CTATGTGGGTGGGATGAGGTTGG - Intergenic
1074881954 10:117666494-117666516 GTGTGTGGGTGGGGTGGGTTGGG + Intergenic
1075300332 10:121316634-121316656 CTGTGTAGGTGAGGTGGGGGTGG + Intergenic
1075586865 10:123664974-123664996 CTGTGGGGAAGGGGTGGGGATGG - Intergenic
1076481883 10:130790084-130790106 GTGTGTGGGTTGAGTGTGGTGGG - Intergenic
1076481896 10:130790192-130790214 ATGTGTGGGTTGAGTGTGGTGGG - Intergenic
1076481944 10:130790569-130790591 GTGTGTGGGTAGAGTGTGGTGGG - Intergenic
1076481970 10:130790765-130790787 ATGTGTGGGTAGAGTGTGGTGGG - Intergenic
1076481976 10:130790814-130790836 ATGTGTGGGTTGAGTGTGGTGGG - Intergenic
1076482091 10:130791606-130791628 CTGTATGTGTGGGGTGTGTGTGG - Intergenic
1076630156 10:131847479-131847501 CTGCCTGTGAGGGGTGTGGACGG + Intergenic
1076717662 10:132374585-132374607 CTGTGTCTGTGGGGTGGGGGTGG + Intronic
1076819303 10:132930767-132930789 CTGTGTGGGGAGTGTGGGGAAGG - Intronic
1076819431 10:132931207-132931229 CTGTGTGGGGAGTGTGGGGAAGG - Intronic
1076844994 10:133065612-133065634 ATGGGTGGGTGGATTGTGGATGG + Intergenic
1077004852 11:349618-349640 TTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1077004870 11:349775-349797 TTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1077004885 11:349879-349901 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1077004905 11:350026-350048 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1077004914 11:350099-350121 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077097093 11:803694-803716 CTGTCTGGCTGGGGTGGGGGTGG - Intronic
1077173680 11:1179329-1179351 GTGTGTGGGGCGGGTGGGGAAGG + Intronic
1077315000 11:1915625-1915647 CTGTGTGTGTGTGTTGTGGGGGG + Intergenic
1077320685 11:1939646-1939668 CTGTGTGTGTGTGTTGTGGGGGG - Intergenic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077442125 11:2573749-2573771 CTGTGCGGGAGGGGTGGGGCAGG + Intronic
1077473474 11:2775661-2775683 CTGGGGTGGTGGGGGGTGGAAGG + Intronic
1078466368 11:11553412-11553434 CTGTGGAGGTGGGCTTTGGAGGG - Intronic
1078475102 11:11622684-11622706 CGGTGGGGGTGGGGGGTGGGGGG - Intergenic
1078488913 11:11751250-11751272 GTGTGTGGGGTGGGTGGGGAGGG - Intergenic
1078616123 11:12867821-12867843 CTGGGTGGGTGGGGAGCAGAGGG + Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1079073530 11:17368464-17368486 GTGTGTGGGTGGCATGTGCAGGG + Intronic
1079116037 11:17641110-17641132 CGGGGTGGGTGGGGTTGGGAGGG + Intronic
1079214680 11:18498066-18498088 GTGTGTGGGTGGGGGGTTGGAGG + Intronic
1079385064 11:19971511-19971533 CTGTGTGGCTGGGGTGTTACCGG - Intronic
1079676147 11:23229359-23229381 GTGTGTGGGTGTGGAGTGGGTGG - Intergenic
1080371159 11:31645867-31645889 GGGTGGGGGTGGGGTGTGGCTGG - Intronic
1080451847 11:32384488-32384510 GTGTGTGGGTGGGTGGTGGTCGG - Intergenic
1080568208 11:33531782-33531804 CTAAGTGGGTTGGGTGTGGGTGG + Intergenic
1081155417 11:39683943-39683965 TTGTGTGTGTTGGGGGTGGAAGG - Intergenic
1081532008 11:43968335-43968357 CTGTGTGGGTGTGGGGTCGTGGG - Intergenic
1081622018 11:44624265-44624287 GTGTGGAGGTGGGGAGTGGAAGG + Intergenic
1081662986 11:44899805-44899827 CAGTGTGGGTGGGGCCTGTAGGG - Intronic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1081864135 11:46350499-46350521 GTATGTGGGTGGGGTGGGGAGGG - Intronic
1082076987 11:47981667-47981689 GGGTGAGGGTGGGGTGGGGAGGG - Intronic
1082189186 11:49221906-49221928 CTTTGAGGGTGAGGTGGGGATGG - Intergenic
1082272004 11:50182630-50182652 ATGTGTGGGAGGTGTGAGGAAGG - Intergenic
1083314553 11:61806393-61806415 CTGGGTGTTTGGGGTGTAGAGGG - Intronic
1083331136 11:61898932-61898954 CTGTGGGGGGAGGGGGTGGAGGG + Intronic
1083711857 11:64554535-64554557 AAGTGTGGGTGAGGTGTGGGTGG - Intergenic
1083721651 11:64606595-64606617 GTGGGTGGGTGGGGTGGGGTGGG - Exonic
1084040041 11:66537307-66537329 TGATGTGGGTGGGGTGTGGGTGG + Intronic
1084086250 11:66856668-66856690 ATGTGTGGGTGTGTTGGGGAGGG + Intronic
1084288110 11:68144966-68144988 GTGTGTGTGTGTGGTGTGTATGG + Intergenic
1084494050 11:69493988-69494010 CTGTGTTCATGGCGTGTGGAGGG + Intergenic
1084556426 11:69878860-69878882 GTGTGTTGGTGGAGTGAGGATGG - Intergenic
1085045809 11:73352766-73352788 CTGTGTAGGTGTGGTGGGGGCGG + Intronic
1085164382 11:74383594-74383616 CTGTCTGGGAGGCGTGGGGAGGG - Intronic
1085510494 11:77085747-77085769 GTGTGAGGGTGGGCTGGGGAGGG + Intronic
1086677332 11:89624759-89624781 CTTTGAGGGTGAGGTGGGGATGG + Intergenic
1086738882 11:90341929-90341951 CTGTGTGTGTTGGGAGTGCAGGG - Intergenic
1087374337 11:97323025-97323047 CTGAGTTGGTGGGCTGGGGAAGG + Intergenic
1087435316 11:98109859-98109881 TTGTGTGTGTGGGGTGAGGTAGG + Intergenic
1087632818 11:100670608-100670630 GTGTGTGGGGGGGGTGTTAAAGG - Intergenic
1087642116 11:100766231-100766253 GTGTGTGTGTGTGGTGTGGGGGG + Intronic
1087691673 11:101327449-101327471 AAGGGTCGGTGGGGTGTGGAAGG + Intergenic
1088000769 11:104877368-104877390 GTGTGTGGGGGGGGTGGGGTGGG + Intergenic
1088285703 11:108185207-108185229 ATGGGTGGTTGGGGTGTGCATGG - Intronic
1088549796 11:111000992-111001014 ATTTGTGGGTGGGCTGAGGATGG + Intergenic
1088619213 11:111664683-111664705 GTGTGTGGGGGGGGTGGTGATGG - Intronic
1088775504 11:113078557-113078579 ATGTTTGGATGGGGAGTGGAGGG + Intronic
1088962139 11:114679308-114679330 CGGTGGGGGTGGGGTGGGGGTGG + Intronic
1089013501 11:115148542-115148564 GTGTGTGGGTGGAGTGTGTGAGG + Intergenic
1089094906 11:115911862-115911884 ATGACTGGGTGGGGTGAGGAGGG + Intergenic
1089161308 11:116439663-116439685 CTCTGGGGGTGGGGTGGGGTGGG + Intergenic
1089397881 11:118147693-118147715 CTGTTTGTGGGGGCTGTGGAGGG - Intronic
1089564067 11:119361608-119361630 CTGGGGGGGAGGGGTGTGGGTGG + Intronic
1089565935 11:119371805-119371827 ATGTGTGGGTGGTGGGTGGGTGG - Intronic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1089590977 11:119540550-119540572 CTGTGTGGGTTGGGAGTGCTGGG - Intergenic
1089602432 11:119624036-119624058 CTGTCTGGGCAGGGTGTGGGTGG + Intronic
1089665487 11:120015339-120015361 CTGTGTGTGTGTGTTGTGGGGGG - Intergenic
1089689683 11:120179518-120179540 GTGTGAGGGTGGGGTGTTGTGGG - Intronic
1089778918 11:120859507-120859529 CTCTGTGTGTGGGGAGAGGATGG + Intronic
1090159969 11:124482198-124482220 TTGTGGGGGTGGGGTGGGGGGGG + Intergenic
1090456885 11:126857779-126857801 CTGTGGGGGTGGGGTGGGTGAGG + Intronic
1090534671 11:127627400-127627422 GTGTGAGGGTGGGGTGGGGAGGG + Intergenic
1090665979 11:128915120-128915142 CTGTGTTGGTTGGGTGCTGAAGG - Intronic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1091150871 11:133326923-133326945 GTGTGTGTGTGGGGCGTGGGTGG + Intronic
1091150902 11:133327044-133327066 ATGTGTGTGTGGGGTGTGGGTGG + Intronic
1091187368 11:133658491-133658513 ATGGGTGGGTGGGTGGTGGATGG + Intergenic
1091250638 11:134141280-134141302 CTCTCTGGGTGCGGTGTGAAGGG + Intronic
1091255058 11:134176447-134176469 CGTGGTGGGTGGGGTGTGGCTGG - Intronic
1091365444 11:135016117-135016139 CTGGCTGGGTGAAGTGTGGAGGG - Intergenic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091395612 12:152692-152714 CTGTGTGTGTGTGGGGTGGCAGG - Intronic
1091670613 12:2449648-2449670 CTGTGTGGGAGTGGTGGAGAGGG - Intronic
1091781304 12:3216129-3216151 GGGTGGGGGTGGGGTGGGGATGG - Intronic
1091823286 12:3491884-3491906 GTGTGTTGGTGGGGGGTGGGGGG + Intronic
1091908267 12:4206821-4206843 GTTTGTGGGTGGGGGGTGGGCGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092253959 12:6916265-6916287 GTGTGTGTGTGGGGTGGGGGTGG + Intronic
1092911506 12:13149115-13149137 CTGTGTGTGTGGTGTGTAGGAGG + Intergenic
1093625945 12:21348367-21348389 CTGTGAGGGAGAGGTGAGGATGG - Intronic
1093670028 12:21862682-21862704 GTATGTGTGTGGGGTGGGGAGGG - Intronic
1094140537 12:27176876-27176898 CTGTGTGGGGGGGGTGTGTGTGG - Intergenic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094707957 12:32933021-32933043 CGGGGGGGGTGGGGTGGGGATGG + Intergenic
1095393729 12:41739997-41740019 GTGTGTGTGTGGGGTGTGGGGGG - Intergenic
1095399990 12:41802919-41802941 CTGTGTGGATTGGATTTGGATGG + Intergenic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095620152 12:44243775-44243797 GTGGGAGGGTGGGGGGTGGATGG - Intronic
1095730121 12:45497581-45497603 CTGTCTGGGAGAGGTGTGGGTGG - Intergenic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1096221018 12:49828232-49828254 CGGGGGGAGTGGGGTGTGGAGGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096514450 12:52148358-52148380 CTGTGTGTGTGGGATGGGGCAGG + Intergenic
1096540196 12:52302825-52302847 CTGCTTGGGTGGGGGGTGGGGGG + Intronic
1096542951 12:52318403-52318425 GTGTGTGGTTGGGGAGTGGGAGG + Intronic
1096627337 12:52903869-52903891 CGGTGTGGGTGGGGTGGGGTGGG - Intronic
1096797360 12:54086212-54086234 CTGGGTGGTTGGGGAGTGGGAGG - Intergenic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1097193250 12:57230296-57230318 CTGTGTGGGAGTGGTGGGGGTGG - Intronic
1097555192 12:61127793-61127815 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1099228869 12:80000400-80000422 CTGTATGGGGGGATTGTGGATGG - Intergenic
1099455858 12:82862013-82862035 CTGAGTTAGTGGGGTCTGGAAGG + Intronic
1099865670 12:88277831-88277853 CTGGGTGGGGGGAGTGTGGAGGG - Intergenic
1099929542 12:89057858-89057880 CTGTTTTTATGGGGTGTGGATGG + Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101301709 12:103489672-103489694 CTGTGAGGCTGCAGTGTGGATGG - Intronic
1101423282 12:104566573-104566595 TTGTGAGGGTGGGTTCTGGAGGG + Intronic
1101845962 12:108363178-108363200 GTGTGTGTGTGGAGTGTGGGGGG + Intergenic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102145085 12:110649203-110649225 CAGTGTGGGGTGGGAGTGGATGG + Exonic
1102614210 12:114138859-114138881 CTGTATGGGTAGGGTATGGAAGG + Intergenic
1102729668 12:115097203-115097225 CTGAGTGGTTGGGGGGTGCAGGG - Intergenic
1103276990 12:119720198-119720220 CTATGTGTGTGGGCTGGGGAGGG + Intronic
1103424721 12:120823206-120823228 GTGTGGGGGTGGGGGGTGGGGGG + Intronic
1103426982 12:120844527-120844549 CCATGTGTGTGGGGTGTGGGGGG - Intronic
1103726275 12:122998777-122998799 CTGGGTGGGTGGGGAGGGCAGGG + Intronic
1103797096 12:123510678-123510700 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797109 12:123510843-123510865 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797113 12:123510919-123510941 GTGTGTGTGTGGTGTGTGTAAGG + Intronic
1103797123 12:123511041-123511063 CTGTGTGTGTGTGGTGTGTGGGG + Intronic
1103797134 12:123511180-123511202 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797168 12:123511594-123511616 CTGTGTGTGTGGTGTGTGTGAGG + Intronic
1103797208 12:123512167-123512189 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797264 12:123512928-123512950 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797278 12:123513114-123513136 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103912165 12:124358426-124358448 CTGTGTGTGTGTGTTGTGGCGGG + Intronic
1104088019 12:125493564-125493586 CTGTGTGCTTGGGGTGGGGGTGG + Intronic
1104354597 12:128074255-128074277 CTATTTTGCTGGGGTGTGGAGGG - Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104566884 12:129893395-129893417 CAGGGTGGGTAGGGTGGGGAGGG - Intronic
1104749486 12:131229405-131229427 CTGCTGGGGTGGGGTGGGGAGGG + Intergenic
1104776402 12:131392519-131392541 GGGTGTGGGTGTGATGTGGAGGG + Intergenic
1104776409 12:131392543-131392565 GGGTGTGGGTGTGATGTGGAGGG + Intergenic
1104776439 12:131392659-131392681 GGGTGTGGGTGTGATGTGGAGGG + Intergenic
1104776451 12:131392706-131392728 GGGTGTGGGTGTGATGTGGAGGG + Intergenic
1104776495 12:131392868-131392890 GGGTGTGGGTGTGATGTGGAGGG + Intergenic
1104776582 12:131393190-131393212 GGGTGTGGGTGTGATGTGGAGGG + Intergenic
1104776589 12:131393214-131393236 GGGTGTGGGTGTGATGTGGAGGG + Intergenic
1104776699 12:131393642-131393664 GTGGGTGGGTGTGATGTGGAGGG + Intergenic
1104907728 12:132223124-132223146 GTGTGTGTGTGGGGTGTGTGTGG - Intronic
1105295828 13:19087444-19087466 GTGTGTTGGTGGGGTGGGGGTGG - Intergenic
1105437999 13:20393126-20393148 CTGTGTGTGTGTGGTGTGGCTGG - Intergenic
1105604511 13:21915761-21915783 CTGTGTGAGGGCGGAGTGGATGG - Intergenic
1106299915 13:28454029-28454051 CTGGGTGGGGGGAGTGGGGAAGG + Intronic
1106408047 13:29490995-29491017 GTGTGTGTGTGTGGTGTGGGAGG + Intronic
1106560785 13:30844273-30844295 GTGTGTGGGTGTGGTGTGTGTGG + Intergenic
1106759188 13:32850861-32850883 CCGTGGGAGTGGGGTGTGGGAGG + Intergenic
1107127225 13:36858655-36858677 CTGTGAGGATGGGGTGGGCATGG - Intronic
1107484461 13:40813123-40813145 GTGTGTGGGTGGGGGGGGGGGGG - Intergenic
1107985005 13:45767971-45767993 CTGTGTGTGTGTGGTGGGGGCGG + Intergenic
1108211268 13:48142083-48142105 ATGTGGGGGTGGGGAGTGGTGGG + Intergenic
1109267694 13:60219942-60219964 GTGGGTGGGAGGGGGGTGGATGG + Intergenic
1109398173 13:61788757-61788779 GTGTGGGGGTGGGGTGGGGCGGG - Intergenic
1110383027 13:74876253-74876275 GTGTGTGGGTGGTGGGTGGGGGG - Intergenic
1110486631 13:76052003-76052025 CTGTTTCAGTGGGGTGTGTAGGG - Intergenic
1110839695 13:80127808-80127830 CTGAGTGACTGAGGTGTGGAGGG + Intergenic
1112035542 13:95493217-95493239 CTGGGTGGGTGGGGCAGGGAAGG - Intronic
1112447373 13:99476574-99476596 GTGTGTGGGGGGGGGGTGGCGGG - Intergenic
1112832063 13:103465010-103465032 CTGTGTCGAGGGGGTGGGGAAGG + Intergenic
1113039186 13:106085701-106085723 GTGTGTGTGGGGGGTGGGGAGGG + Intergenic
1113406283 13:110043547-110043569 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1113607550 13:111621271-111621293 CTGTGTGTGTGGTGTGTGTGTGG + Intronic
1113795680 13:113056337-113056359 CTGTGTGGGTGTGGAGTGTTTGG + Intronic
1113795721 13:113056665-113056687 CTGTGTGGGTGCGGAGTGTTTGG + Intronic
1113798572 13:113074724-113074746 TGCTGTGGGTGGGGTGTGGGAGG - Intronic
1113916517 13:113877260-113877282 TTGTGTGGGTAGCGTGTGGGTGG + Intergenic
1113923641 13:113928549-113928571 CAGCGAGGGTGGGGTGTGGGAGG - Intergenic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1113971265 13:114192064-114192086 GTGGGTGGGTGGGGGGAGGAAGG + Intergenic
1114377094 14:22158671-22158693 GTGTGTGTGTGGGGCGGGGAGGG + Intergenic
1114699295 14:24661309-24661331 GAGTGTGGGTGGGGTTTGGGAGG + Intergenic
1115306912 14:31943347-31943369 CTGTGAGGGTGGGGTGAGTGGGG - Intergenic
1115387813 14:32818324-32818346 GTGTGTGTGTGTGGTGGGGAAGG - Intronic
1115671536 14:35617623-35617645 GTGTGTGTGTGGGGTGGGGGGGG + Intronic
1115888813 14:38004296-38004318 GTGTGTGAGTGGGGTGGGGTGGG + Intronic
1116572848 14:46539674-46539696 CTGTGTGGGAAGGGAGTGGCAGG + Intergenic
1116590852 14:46770677-46770699 ATTTGGGGGTGGGGTGGGGAAGG - Intergenic
1117423632 14:55573265-55573287 CTGGGGGGTTGGGGTGTGGTTGG - Intronic
1117627672 14:57656293-57656315 GTGTGTGTGGGGGGTGTGGGGGG - Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118441702 14:65817975-65817997 CTCTGTGTGTGGTGTGTGTATGG - Intergenic
1118467600 14:66045136-66045158 GTGTGTGGGTGGGGTGGGGTGGG + Intergenic
1118764172 14:68899107-68899129 TGGTGTGGTTGTGGTGTGGAGGG - Intronic
1118846223 14:69549570-69549592 CTGGGTGGGAAGGGTGTGGGAGG + Intergenic
1118874457 14:69771561-69771583 CTGTGGGGGTGGGATTTGGAAGG + Exonic
1118907154 14:70031408-70031430 CTGGGTGGGTGGGTTGGGGGAGG + Intronic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119107239 14:71936394-71936416 TTGTGTCAGTGGGCTGTGGAAGG - Intronic
1119195789 14:72715837-72715859 CTGCAGGGGTGGGGTGGGGAGGG - Intronic
1119196011 14:72717068-72717090 CTGTGTAAGTGGGTTGTAGATGG - Intronic
1119348952 14:73948760-73948782 CTGGTGGGGTGGGGTGTGGAGGG - Intronic
1119535181 14:75397009-75397031 GTGTGTAGGTGGGGTGAGGTTGG + Intergenic
1119554891 14:75545755-75545777 GTGTGTGGGTGGGAGGTGGCGGG - Intronic
1119554985 14:75546392-75546414 CAAGGTGGGTGGGGTGCGGAGGG - Intronic
1119644322 14:76337548-76337570 GTGTGTGGGCGGGGGCTGGATGG + Intronic
1120219196 14:81713492-81713514 ATGGCTGGGTGGGGTTTGGATGG + Intergenic
1120671828 14:87371471-87371493 CTGTGTGAGTGGAGTCTTGAAGG + Intergenic
1121014885 14:90542733-90542755 TGGGGTGGGTGGGGTGGGGAGGG + Intronic
1122145528 14:99686741-99686763 CTGAGTGTGTGGGGTGCGGAGGG + Intronic
1122268221 14:100556612-100556634 CTGTAGGGCTGGGGTGAGGATGG - Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122635476 14:103127674-103127696 CTCTGTAGGAGGGGTGTCGAGGG + Intronic
1122657393 14:103271390-103271412 GTGTGTGGGGGGGGTGTGGGGGG - Intergenic
1122811652 14:104292253-104292275 CGGTGTGGGTGGGGGAGGGAGGG + Intergenic
1122879472 14:104683605-104683627 CTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1122913591 14:104845517-104845539 CACTGTGGGTGGGGTGGGGGAGG - Intergenic
1122969752 14:105147747-105147769 GAGTGTGGGAGGGGTGTGGGCGG - Intronic
1202903449 14_GL000194v1_random:55869-55891 CGGGGTGGGTAGGGTGTGGGTGG - Intergenic
1123432116 15:20226790-20226812 CTGGGTGTGTGAGGGGTGGAGGG - Intergenic
1123796972 15:23782091-23782113 TTATGAGGGTGGGGGGTGGAGGG + Intergenic
1123945987 15:25239140-25239162 CTGTGTGTGGGAGGTGTGCAGGG + Intergenic
1124011536 15:25843220-25843242 CGGTGGGGGTGGGGGGTGGGGGG - Intronic
1124349564 15:28945064-28945086 CTGTGTGGCTGTGGTGTGCTGGG - Intronic
1124531015 15:30506501-30506523 TTGTGTGGGTAGGGTGTATATGG + Intergenic
1124531022 15:30506529-30506551 GTGTGTGGGTAGGGTGTATATGG + Intergenic
1124551304 15:30683421-30683443 CTGCGTGGCTGAGGTGAGGAGGG + Intronic
1124679943 15:31722244-31722266 CTGCGTGGCTGAGGTGAGGAGGG - Intronic
1124767633 15:32501166-32501188 GTGTGTGGGTAGGGTGTATATGG - Intergenic
1124767640 15:32501194-32501216 TTGTGTGGGTAGGGTGTATATGG - Intergenic
1124875112 15:33584776-33584798 CTGGGTGGGTGAGGTGGGGGTGG - Intronic
1124915048 15:33962024-33962046 CTTTCTGTGTGGGGTGTGGTTGG - Intronic
1125362684 15:38880592-38880614 CTGTGTGACTAGGGTGGGGAAGG + Intergenic
1125471473 15:40008604-40008626 GTGTGTGTGTGGGGTGGGGAGGG - Intronic
1125734054 15:41911476-41911498 TGGTGTGGGTGGGCTGGGGAGGG + Intronic
1125751693 15:42033577-42033599 CTGGGTGGGTGGGGTGGGAGGGG + Intronic
1125884787 15:43220641-43220663 CTGTGGGGGGGGGGTGTGGTAGG - Intronic
1126164370 15:45641943-45641965 CAGTGAGGGTGGGGTCTGAATGG - Intronic
1126506549 15:49411000-49411022 GTGTGTGGGGGGGGTGGGCAGGG + Intronic
1126660154 15:51025328-51025350 ATATGTGGGTGTGGTGTGGTTGG - Intergenic
1127251951 15:57247979-57248001 CTGTGGGGGTGGGGTGGTGGGGG - Intronic
1127295917 15:57608341-57608363 CAATGTGGGTGTGTTGTGGATGG + Intronic
1127633721 15:60849819-60849841 CAGGGTTGGTGGGATGTGGATGG + Intronic
1127634605 15:60857429-60857451 TTGTGTGGATGGGGTGTTCAAGG - Intronic
1127805054 15:62511587-62511609 CGCTGGGGGTGGGGTGGGGAGGG - Intronic
1128054427 15:64689226-64689248 GGGTGGGGGTGGGGTGTGAATGG - Intronic
1128054556 15:64690006-64690028 CTTCCTGGGTGGGGTGTGAATGG + Intronic
1128080910 15:64856403-64856425 CTATGTGGATGTGGGGTGGAGGG + Intronic
1128214408 15:65924353-65924375 GTGGGTAGGTGGGGTGTGGGTGG + Intronic
1128228001 15:66015892-66015914 CTGTGTGGGTGGGGTTGGGTGGG + Intronic
1128241016 15:66100984-66101006 GTGAGTGGGTGGTGGGTGGATGG + Intronic
1128306709 15:66603705-66603727 CTCTGGGGGTGGGGTGGGGATGG + Intronic
1128528455 15:68428406-68428428 CTGTGTGGATGGGCTGGGAATGG + Intronic
1128623780 15:69177755-69177777 TTGAGAGGGTGGAGTGTGGAGGG - Intronic
1128732107 15:70028311-70028333 GTGGGTGGGTGGGGTGGGGATGG + Intergenic
1128734443 15:70044930-70044952 ATGTGTGGGTGGGTAATGGATGG + Intergenic
1128875713 15:71199476-71199498 GTGTGTGTGTGGGGTGTGTGTGG + Intronic
1128875717 15:71199504-71199526 GTGTGTGTGTGGGGTGTGTGTGG + Intronic
1129113645 15:73352830-73352852 CTGTCTGGTTGGGGAATGGAGGG - Intronic
1129210423 15:74064914-74064936 CAGTGTGTGTGGGCTGGGGAGGG + Intergenic
1129235502 15:74221590-74221612 CTGTGTGGGTGGGGAGGTGATGG + Intergenic
1129356342 15:74994552-74994574 TGGTGTGGGTGGGGGGTGGAGGG + Intronic
1129403591 15:75300459-75300481 CAGTGTGTGTGGGCTGGGGAGGG - Intergenic
1129696450 15:77743086-77743108 CTGAAAGGGTGGGGGGTGGAAGG + Intronic
1129878612 15:78993012-78993034 CCATGTGGGTGGTGTGTGGGTGG + Intronic
1129878619 15:78993045-78993067 CCATGTGGGTGGTGTGTGGGTGG + Intronic
1129934487 15:79437911-79437933 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934496 15:79437941-79437963 GTGAGTGTGTGGGGTGTGGGTGG + Intronic
1129934532 15:79438058-79438080 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934577 15:79438221-79438243 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934586 15:79438252-79438274 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934671 15:79438553-79438575 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934681 15:79438584-79438606 GTGAGTGTGTGGGGTGTGGGTGG + Intronic
1129934705 15:79438663-79438685 CATAGTGTGTGGGGTGTGGATGG + Intronic
1129934723 15:79438721-79438743 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934731 15:79438752-79438774 GTGAGTGTGTGGGTTGTGGATGG + Intronic
1129934749 15:79438814-79438836 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934758 15:79438845-79438867 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934776 15:79438907-79438929 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934785 15:79438938-79438960 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1129934818 15:79439059-79439081 GTGAGTGTGTGGGGTGTTGATGG + Intronic
1129934836 15:79439117-79439139 GTGAGTGTGTGGGGTGTGGATGG + Intronic
1130258635 15:82337571-82337593 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1130270050 15:82441513-82441535 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1130303598 15:82698748-82698770 ATTTGTGGGTGTGGTGAGGAAGG - Intronic
1130468289 15:84203721-84203743 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130481418 15:84361816-84361838 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1130485460 15:84396021-84396043 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130490287 15:84425959-84425981 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1130495977 15:84469821-84469843 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1130590582 15:85208319-85208341 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130596288 15:85252389-85252411 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1131791867 15:95973898-95973920 GTGTGTGTGTGTGGTGTGTATGG + Intergenic
1131830521 15:96352077-96352099 CCGGGGGGGTGGGGCGTGGAGGG + Intergenic
1132185373 15:99798507-99798529 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1132239890 15:100249464-100249486 CAGTGCAGGTGGGGTGGGGAGGG + Intronic
1132431617 15:101766021-101766043 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1132431644 15:101766123-101766145 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic
1132456444 16:26311-26333 GAGAGTGGGAGGGGTGTGGACGG - Intergenic
1132510461 16:338427-338449 CTGTGTGGGTGGGTTGTGAAAGG - Intronic
1132666562 16:1083595-1083617 GAGAGTGGGTGGGGTGGGGACGG + Intergenic
1132758914 16:1499598-1499620 CTGAGGGGGTGGGGTGGGGTGGG + Intronic
1132791471 16:1691773-1691795 CTGCGGGGGTGGGGTGGGGTGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132891251 16:2205825-2205847 CCGTGTGCGTGGGGCGGGGATGG + Intronic
1133314250 16:4872448-4872470 TTGTGTGTGTGGGGGGTGGGTGG + Intronic
1133383180 16:5347956-5347978 ATGGGTTGGTGGGGAGTGGATGG - Intergenic
1133391471 16:5413791-5413813 CGGTAGGGGTGAGGTGTGGAGGG + Intergenic
1133441496 16:5824570-5824592 CTGTCTGGCTGAGGTGTGGAAGG + Intergenic
1134093841 16:11405896-11405918 CTGGGTGGGTGGGGAATGGTAGG - Intronic
1134135074 16:11672339-11672361 CTGTAGTGGTGGGGTGTGGGAGG + Intronic
1134197534 16:12170458-12170480 CAGTGGGGGAGGCGTGTGGATGG + Intronic
1134203303 16:12216707-12216729 AGGGGTGGGTGGGGTGGGGAGGG - Intronic
1134793881 16:17016507-17016529 GTGTGTGTGTGTGGTGTGGAGGG + Intergenic
1135346160 16:21690338-21690360 TTGTGGGGGTGGGGTGGGGGAGG - Intronic
1135540269 16:23324689-23324711 GTGTGTGTGTGGGGTGGGGTAGG - Intronic
1135840616 16:25873151-25873173 GTGTGTGGGTGATGGGTGGATGG - Intronic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136071726 16:27791528-27791550 ATGTGTGGGTGGGGGGCGGTGGG - Intronic
1136114953 16:28088775-28088797 GTGTGTGTGTGGGGTGTGTAAGG - Intergenic
1136114979 16:28088896-28088918 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1136115024 16:28089052-28089074 GTGTGTGGGGGGTGTGTGGGGGG - Intergenic
1136115029 16:28089063-28089085 GTGTGTGTGTGGTGTGTGGGGGG - Intergenic
1136115042 16:28089115-28089137 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1136115081 16:28089325-28089347 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1136115086 16:28089352-28089374 GTGTGTGGGTGTGGTGTGAGGGG - Intergenic
1136315000 16:29449268-29449290 CTGGGAGGGTGGGGTGGGGCTGG + Intronic
1136429577 16:30188607-30188629 CTGGGAGGGTGGGGTGGGGCTGG + Intronic
1136554363 16:30999046-30999068 TTTTGGGGGTGGGGGGTGGAGGG - Intronic
1136653488 16:31693812-31693834 GTGTGTGTGTGTGGTGTGTATGG - Intergenic
1136653500 16:31693870-31693892 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1136852522 16:33624349-33624371 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1137256272 16:46777994-46778016 TTGTGGGGGCGGGGTGTGGGGGG + Intronic
1137792794 16:51188981-51189003 CTGTGGGGCTGAGGTGTAGATGG - Intergenic
1137863228 16:51867889-51867911 CTGGGTGGGTGGGGTGTGGGGGG + Intergenic
1137959421 16:52866910-52866932 CTGTCTGGGTGGGGCGGGGCGGG - Intergenic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138595704 16:58027861-58027883 CTGTGTGAATGGGGTGGGGGAGG - Intronic
1138613814 16:58148456-58148478 AAGTGTCGGTAGGGTGTGGAGGG - Intergenic
1139250647 16:65492226-65492248 GTGTGTGTGTGTGGTGTGGCAGG - Intergenic
1139291972 16:65867591-65867613 GTGTGGGGGTGGGGGCTGGAGGG - Intergenic
1139433235 16:66922354-66922376 CTGTGTGGGTGGGGAAAGGCAGG + Intronic
1139954093 16:70685198-70685220 CTGTGGGGGTGGGGCGGGGCTGG + Intronic
1140200039 16:72887628-72887650 CAGTGTGTGTGGGGTGTGTGGGG + Intronic
1140235094 16:73151915-73151937 CTGTGTGGGTGGGGTGGGGGTGG - Intergenic
1140669569 16:77263929-77263951 CTGTGTGGGGGTGGGGAGGAGGG - Intronic
1141160536 16:81626549-81626571 ATGTGTGTGTGGTGTGTGGGTGG + Intronic
1141160545 16:81626611-81626633 GTGTGTGTGTGGTGTGTGGGTGG + Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141918817 16:87121012-87121034 CTGGGTGGGTGGGGCGTCGGGGG + Intronic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142153731 16:88523841-88523863 CTGTGCGGGTGGGGAGGGGCAGG - Intronic
1142215406 16:88827277-88827299 CCGAGTGGCTGGGGTGGGGACGG + Intronic
1142309378 16:89303440-89303462 ATGTGTGGATGGGTTGTGTAAGG - Intronic
1142385987 16:89765150-89765172 TTGTGTGTGTGGGCTGTTGATGG - Intronic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1203114122 16_KI270728v1_random:1472817-1472839 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1142716131 17:1747923-1747945 CTGTCTGGGTGTGGTGGGGATGG + Intronic
1142941079 17:3380158-3380180 CTCTGTGGGTGAGCTGTGGAGGG + Intergenic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143097532 17:4486338-4486360 CTGCGTGTGTGGGGTGGGGAGGG + Intronic
1143166683 17:4900423-4900445 CTGTGTGGACGGGGTCTGCAGGG + Exonic
1143225517 17:5299118-5299140 GTGTGTGGAGGGGGTGTGGTGGG + Intronic
1143343651 17:6233759-6233781 CTCTCTGGGCGGGTTGTGGAGGG + Intergenic
1143425624 17:6834679-6834701 CTGGATGGCTGGGGTGTGGAGGG + Intergenic
1143448958 17:7024328-7024350 CTCTGTGGGTGAGGTGTTAAGGG + Intronic
1143469231 17:7161393-7161415 GTGTGTGTGTGGGGTGGGGGGGG - Intergenic
1143498858 17:7327399-7327421 CAGTGGTGGTGGGGTGGGGACGG - Intronic
1143518926 17:7434773-7434795 CTGCCTGGGTGGGGTGGGGGGGG - Intergenic
1143650076 17:8257937-8257959 TGGTGAGGCTGGGGTGTGGAGGG + Exonic
1143659334 17:8315110-8315132 CTGTGGGGGGTGGGTGAGGATGG + Exonic
1143841680 17:9737220-9737242 GTGTGTGTGTGGGGGGTGGGGGG + Intergenic
1143864098 17:9911481-9911503 CTCTGGGGGTGGGGTGAGGTTGG - Intronic
1144530034 17:16028687-16028709 CTGTGGGGGTGGGATGTGAGTGG + Exonic
1144632518 17:16881402-16881424 CTGAGCTGGTGGGGTGGGGAGGG + Intergenic
1144729384 17:17517892-17517914 CTGGGTGGGTGGGGTGCAGGCGG - Intronic
1144734757 17:17548877-17548899 CTGTCTGGGCAGTGTGTGGAGGG + Intronic
1144752941 17:17662632-17662654 CGGTGTGGGTGGGATGGGCAAGG - Intergenic
1144754715 17:17672079-17672101 CTGGGTGGCGGGGGTGGGGAGGG + Intergenic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1144836195 17:18157908-18157930 CAGTGTGGGTGGGGTGGGGCGGG + Intronic
1144966093 17:19078079-19078101 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1144966194 17:19078360-19078382 CTGGGTGGGTGGGGACTGGGTGG + Intergenic
1144981724 17:19173697-19173719 CTGGGTGGGTGGGGACTGGGTGG - Intergenic
1144981770 17:19173815-19173837 CTGGGTGGGTGGGGACTGGGTGG - Intergenic
1144981875 17:19174110-19174132 CTGGGTGGATGGGGAGTGGGTGG - Intergenic
1144986348 17:19204129-19204151 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1144986454 17:19204424-19204446 CTGGGTGGGTGGGGACTGGGTGG + Intergenic
1144986500 17:19204542-19204564 CTGGGTGGGTGGGGACTGGGTGG + Intergenic
1145743423 17:27294654-27294676 CTGTGTGGCTGGGGCGGGCAAGG + Intronic
1145864208 17:28229525-28229547 CTGTGTGGGTGGGGAGTGGGAGG + Intergenic
1146053460 17:29569252-29569274 CCGTGTGTGTGTGGTGGGGAGGG - Intronic
1146061112 17:29607886-29607908 CTGTGGGGCTGGGGTGAGCAGGG - Intronic
1146062496 17:29614522-29614544 CTGGGTGGGTGAGGTGGGGCAGG - Exonic
1146492707 17:33293443-33293465 GTGCGGGGGTGGGGTGTGGTGGG + Intronic
1146925510 17:36742342-36742364 CAGTGTCTGTGCGGTGTGGATGG + Intergenic
1147125654 17:38366326-38366348 CTGTGGGGGTTGGCTGTGCAGGG - Exonic
1147150684 17:38511816-38511838 CTGTGTGCCTGGGCTGTGGAAGG - Exonic
1147170653 17:38616956-38616978 CTGTGTGGCTGGGGTGTTGGTGG - Intergenic
1147176914 17:38661591-38661613 CTCTCTGGGTGGAGTGTGGTGGG + Intergenic
1147427248 17:40351717-40351739 ATGTGTGGGTTGGGTGGGCATGG + Intronic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147717616 17:42518978-42519000 CTGGGTGGTTGGGGTGAGGGTGG + Intronic
1147736254 17:42640433-42640455 CTGGTTGGGTGGGGTATGGGAGG + Intergenic
1147888037 17:43697718-43697740 CTGTGAGGAAGGCGTGTGGAAGG + Intergenic
1147926638 17:43950724-43950746 TTGTGTGGGTGGGGAGTGGGAGG - Intergenic
1148171619 17:45525837-45525859 CTGTTTGGGTGGGGAGGGGAGGG - Intergenic
1148277751 17:46320572-46320594 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148299958 17:46538427-46538449 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148340982 17:46873292-46873314 GTGGGTGGGTGGAGTGGGGAGGG - Intronic
1148364403 17:47042712-47042734 CTGTTTGGGTGGGGAGGGGAGGG + Intronic
1148478396 17:47944223-47944245 GTGTGTGTGTGTGTTGTGGAGGG + Intronic
1148949483 17:51297952-51297974 GTGTGTGTGTTGGGGGTGGAGGG - Intergenic
1149324832 17:55519359-55519381 GTGTGTGGGTGGAATGTGGCGGG + Intergenic
1149549358 17:57528411-57528433 ATGCGTGGGAGGGGTCTGGAAGG + Intronic
1150227580 17:63532209-63532231 CTGCCTGGGTGGGGAGTGGGAGG - Intronic
1150236081 17:63593757-63593779 CACTCTGGGTGGGGTGGGGAAGG - Exonic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150352823 17:64458902-64458924 CTGTTTATGGGGGGTGTGGATGG + Intronic
1150402545 17:64870872-64870894 CTGTTTGGGTGGGGAGGGGAGGG - Intronic
1150915310 17:69430561-69430583 CTGAGTAGGTAGGGTGTAGAAGG + Intronic
1151280553 17:73071000-73071022 CTCTGAGGTTGGGGGGTGGAGGG - Intronic
1151391605 17:73791042-73791064 CTGGTGGGGTGGGGTGGGGAGGG + Intergenic
1151454192 17:74216310-74216332 CTGGCTGTGTGGGGTGTGGGGGG + Intronic
1151820122 17:76492655-76492677 GTGTGGGGGTGGGGAGTGCAGGG - Intronic
1151826937 17:76529049-76529071 TTGCGTGGGTGGGGGGTGGGGGG - Intronic
1151899406 17:77001953-77001975 TGGAGGGGGTGGGGTGTGGACGG - Intergenic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152312623 17:79560062-79560084 GTGGGTGGGTGGTGGGTGGATGG + Intergenic
1152318009 17:79591910-79591932 ATGTGTGGAGGGTGTGTGGAGGG + Intergenic
1152344580 17:79743246-79743268 CTCTGTGGCTGGGCTGGGGAGGG + Intergenic
1152435748 17:80274904-80274926 GTGTGTGAGTGGGGTGTGAGTGG + Intronic
1152435782 17:80275070-80275092 GTGTGTGAGTGGGGTGTGTTGGG + Intronic
1152436787 17:80281218-80281240 GTGTGTGAGTGGGGTGTGTGTGG - Intronic
1152450105 17:80373257-80373279 GTGAGGGGGTGGGGTGTGGGGGG - Intronic
1152611656 17:81317797-81317819 GTGTGCGGGTGGGGTGGGGTGGG + Intronic
1152652615 17:81502517-81502539 CTGTGTGGGGATGCTGTGGACGG + Intergenic
1152851601 17:82639777-82639799 GTGTGTGTGTGGGGTCGGGAGGG + Intronic
1153226615 18:2905286-2905308 CTCTGTGGGTGGGGCGGGGGGGG + Intronic
1153245276 18:3067212-3067234 CTGTGTGACTTGGGTGTGAATGG - Exonic
1153488993 18:5629406-5629428 GTGTGTGTGTGTGGTGTGTAAGG - Intronic
1153835911 18:8963575-8963597 GTGTGTGTGTGGTGTGTGTATGG - Intergenic
1153871948 18:9329940-9329962 GTGGGGGGGTGGGGGGTGGAGGG + Intergenic
1154035620 18:10798971-10798993 GTGTGAGGGTGGGGTGGGGGTGG + Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154165295 18:12010277-12010299 CAGTGGGGGTGGGGTGTGAGGGG - Intronic
1154167428 18:12026663-12026685 AGGTGAGGGTGGGGTTTGGAGGG + Intronic
1154314308 18:13292132-13292154 CTGTCTGGCTGTGGGGTGGATGG + Intronic
1154961150 18:21309899-21309921 CAGTGTGTGTGGGGAGGGGATGG - Intronic
1154981502 18:21506000-21506022 ATGTAAGGGTGGGGGGTGGAGGG + Intronic
1155551667 18:26972021-26972043 AGGTGTGGCAGGGGTGTGGAGGG + Intronic
1156281003 18:35638455-35638477 GTGTGTGTGTGGGGTGGGGAAGG - Intronic
1156450185 18:37262385-37262407 GTGTGTGTGTGGGGTGGGGGAGG + Intronic
1157113754 18:44844316-44844338 GTGTGTGTGTGGGGTGGGGCAGG - Intronic
1157407832 18:47438391-47438413 CTGTGTGGGTGAGTGGTGGAAGG - Intergenic
1157505550 18:48223592-48223614 GTGTGTAGGAGGGGTGAGGATGG + Intronic
1157515474 18:48308148-48308170 GTGTGTGGGTGTGTGGTGGATGG - Intronic
1157700999 18:49761593-49761615 GTGAGTGTGTGGGGTGTGTATGG - Intergenic
1157804524 18:50648323-50648345 CTGTGTGGCTGTGGTGTGGGGGG + Intronic
1158280533 18:55820777-55820799 CTGTGTGGTTGGGGTAGGGGAGG - Intergenic
1158403206 18:57139618-57139640 GGGAGTGGGTGGGGTGGGGAGGG - Intergenic
1158440510 18:57470764-57470786 TTGTGTGTGTGTGGTGTGGAGGG - Intronic
1158625764 18:59070353-59070375 CAATGTGGGTGGGGAGGGGAAGG + Intergenic
1158700370 18:59740031-59740053 CTCTATGGGAGGGTTGTGGAGGG - Intergenic
1158881597 18:61784199-61784221 ATTTGGGGGTGTGGTGTGGAGGG + Intergenic
1159361020 18:67402596-67402618 CTGTGTGTGTGTGGTGGGGTGGG - Intergenic
1160103265 18:75944490-75944512 GTGTCTGGGTGGGCTGGGGAAGG + Intergenic
1160240426 18:77118884-77118906 CTGTGTGTGTGGTGTGTGTCTGG - Intronic
1160404921 18:78638853-78638875 GTGTGTGTGTGGTGTGTGGGTGG - Intergenic
1160483162 18:79261541-79261563 CGGGGGTGGTGGGGTGTGGAGGG - Intronic
1160496464 18:79378905-79378927 CTGTGTGCGTGGGGTTCCGAAGG + Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160632824 18:80258521-80258543 GTGTGTGGGTGTGGTGTGTGTGG + Intergenic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160799211 19:960069-960091 CTGTGAGGGTGGAGAGGGGATGG - Intronic
1160814971 19:1030923-1030945 CTGCGTGGGTGTGGTGAGGGGGG + Intronic
1160926812 19:1550401-1550423 GTGGGTGGGTGGGTGGTGGATGG - Intergenic
1160960054 19:1716785-1716807 GTGTGTGGGTGGGGGATGAACGG + Intergenic
1160977716 19:1802083-1802105 ATGGGTGGGTGAGGGGTGGATGG - Intronic
1160977739 19:1802149-1802171 ATGGGTGGGTGAGGGGTGGATGG - Intronic
1160977749 19:1802179-1802201 ATGGGTGGGTGAGGGGTGGATGG - Intronic
1161055406 19:2188482-2188504 CTGTGCGGGTGGGGGGGGGGGGG - Intronic
1161477141 19:4492853-4492875 CTGTGTGTGTGTGGTGTGTGTGG + Intronic
1161556575 19:4945974-4945996 GTGTGTGGGAGGGGTGGGGGAGG + Intronic
1161583628 19:5093671-5093693 CTGTCTGGGGTGGGTGTGGGTGG - Intronic
1161632869 19:5367715-5367737 TTGGGTGGGTGGGTTATGGATGG + Intergenic
1161657502 19:5525117-5525139 ATGGGTGGGTGGTGGGTGGATGG - Intergenic
1161669675 19:5599178-5599200 CTGTGTGGGTTTAGAGTGGAGGG - Intronic
1161740429 19:6017915-6017937 CTGAGTTGGGGGGGTGGGGATGG - Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162067628 19:8135946-8135968 CTGTGTGGGTGAGTTGGGGGTGG - Exonic
1162320563 19:9968780-9968802 CTGTGTGGGTGGTTAGGGGATGG + Intronic
1162672422 19:12268187-12268209 CTTTGTGACTGGGGTGGGGAAGG - Intronic
1162794049 19:13077632-13077654 CAGTTTGGGTGAGGGGTGGAGGG - Intronic
1162861547 19:13509211-13509233 ATGTGTGTGTGGGGTGGCGAGGG - Intronic
1163108196 19:15140180-15140202 CCTTGAGGGTGGGCTGTGGAAGG - Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163633354 19:18427827-18427849 TGCTGTGGGTGGGCTGTGGAAGG + Intronic
1163719187 19:18890243-18890265 CTGTGTTGGGGAGGTGGGGAGGG - Intronic
1163774119 19:19208044-19208066 TAGTGTGGCTGGGGTGTGGCTGG + Intergenic
1163834126 19:19563003-19563025 CTGTGTGTGTGGTGTGTGCCAGG - Intronic
1163845209 19:19634731-19634753 GAGTGTGGGTGGGCTGTGGAGGG + Intronic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1164144597 19:22504338-22504360 GGGTGAGGGTGGGGTGAGGATGG - Intronic
1164458206 19:28426737-28426759 CTGTGGTGGTGGGGGGTGGGGGG - Intergenic
1164476095 19:28577094-28577116 CTGTGTGTGAGGGGTGGGGTGGG - Intergenic
1164565098 19:29320162-29320184 ATGTGTGTGTGGGATGGGGATGG - Intergenic
1164774998 19:30845967-30845989 CTGACTGGGTAGGGGGTGGATGG + Intergenic
1164902593 19:31940562-31940584 CTGTGTGGGTGGGTTGGCCATGG - Intergenic
1164941887 19:32257228-32257250 CTTTGTGGGTGGGGTGGCGGGGG - Intergenic
1165149786 19:33753774-33753796 GTGTGTGGGTGGTGTGGGGATGG - Intronic
1165354919 19:35298410-35298432 TTGTGTGTGTGGTGTGTGCATGG - Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1165829191 19:38722160-38722182 CTGACTGGGTGGGGAGGGGAAGG - Intronic
1165931811 19:39364038-39364060 CTGTGTGGTGGTGGTGGGGAGGG - Intronic
1165999947 19:39871936-39871958 TTGTGTGGGTGTGGGGTGGGAGG + Intronic
1166219342 19:41354653-41354675 CTGGGTGTCCGGGGTGTGGATGG + Exonic
1166284299 19:41814302-41814324 CTCTGTGGGTGGGAAGTGGTGGG - Intergenic
1166571978 19:43802730-43802752 CTGTGTGGGTGGTGTGTGTTGGG - Intronic
1166652393 19:44584349-44584371 CTGTGGTGGTGGGGAGTGTAGGG + Intergenic
1166882199 19:45936403-45936425 CAGGGTGGGAGGGCTGTGGAAGG + Exonic
1167052315 19:47086733-47086755 CTGTGTGTCTGGGGTGCTGAGGG - Intronic
1167116150 19:47490153-47490175 GTGTGTGTGTGGGGTGTGTGTGG + Intronic
1167116363 19:47491373-47491395 GTGTGTGTGTGGGGTGTGTGGGG + Intronic
1167288063 19:48610001-48610023 CTGTTGGTGTGGGGAGTGGAGGG + Intronic
1167310941 19:48737649-48737671 CTATGTGGGTGGAGTATAGAAGG - Intronic
1167423053 19:49415028-49415050 CTCTGTGGGTGTGGAGTGGATGG - Intronic
1167560408 19:50223483-50223505 CTGTGTGCCTGGGGTGGGGCTGG + Intronic
1167631362 19:50628154-50628176 CTGTGTGTGTGTTGTGGGGAGGG - Intronic
1167707465 19:51090129-51090151 CTTGGTGGGTGGGGTTGGGAAGG + Intergenic
1167997068 19:53414426-53414448 GTGTGTGTGTGTGGTGGGGAGGG - Intronic
1168006850 19:53497107-53497129 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1168305864 19:55435194-55435216 ATGTGTGTGTGGTGTGTGTATGG + Intronic
1168607244 19:57769900-57769922 CTGGGTGGGTAGGGTGGGTAAGG - Intronic
1168684555 19:58340358-58340380 CCGTGTGGCTGGTGTATGGAAGG - Exonic
924958089 2:10055-10077 GTGTGTGGGTGTGGTGTGTGTGG - Intergenic
924958109 2:10139-10161 GTGTGTGGGTGTGGTGTGTGTGG - Intergenic
925205265 2:2000546-2000568 CAGGGTGGGTGTGGTGTGTAGGG + Intronic
925286230 2:2717283-2717305 CTGGGCAGGTGGGGAGTGGAAGG + Intergenic
925291526 2:2751468-2751490 CTGAGTGAGAGGGGTCTGGAGGG - Intergenic
925597365 2:5568982-5569004 CTGCAGTGGTGGGGTGTGGAGGG - Intergenic
925713022 2:6759786-6759808 GTGTGTCTGTGGGGTGTGAAGGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925817521 2:7767997-7768019 CTGTGTGTGTGTGGTGTGTTGGG - Intergenic
925893292 2:8453149-8453171 CTGACTGGGTGTGGTGTTGAAGG - Intergenic
926094603 2:10073094-10073116 CTGTGTGGGAGTGGTGCAGATGG + Intronic
926332450 2:11836830-11836852 CTGTGTCTGTGGGGTGTATATGG + Intergenic
926584540 2:14671911-14671933 CTGTAAGGGTGGAGTGGGGAAGG - Intergenic
926700355 2:15799407-15799429 CTCTGTGGGAGGGGGCTGGAGGG - Intergenic
926912149 2:17861016-17861038 ATGTGGGGGTGGGGTGCGGCAGG + Intergenic
926948525 2:18215939-18215961 GTGTGTGTGTGTGGTGGGGAGGG - Intronic
927105310 2:19818859-19818881 GTGTGTGGGTGGGGAGTGAAAGG - Intergenic
927152491 2:20203976-20203998 CTGTGGGGGTGGGAGGTGGCGGG + Exonic
927399113 2:22690210-22690232 CTGTGTGTGTGAGCTGTGAATGG + Intergenic
927431178 2:23027537-23027559 GTGTGTGGCCAGGGTGTGGAAGG - Intergenic
927436578 2:23071753-23071775 GTCTGTGAGTGGGGTGGGGATGG - Intergenic
927930093 2:27038367-27038389 CTCTGTGGGTGGTAGGTGGAGGG + Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
928455158 2:31414021-31414043 GTGTGTGGGTGGGGAGTGGGGGG + Intronic
928915826 2:36469193-36469215 GTGGGTGGATGGGGTGGGGATGG + Intronic
929229719 2:39547045-39547067 CTGTGAGGGTGGAGTATGCAGGG - Intergenic
929774509 2:44920334-44920356 TTGTGTGTGTGGGTTGTGGGGGG + Intergenic
930019005 2:46989844-46989866 CTGTGTGTGTGTGTTTTGGAGGG + Intronic
931980615 2:67690064-67690086 GTGTGTGTGTGGGGTGGGGGTGG + Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932416189 2:71575126-71575148 CTGTGTGGTTGGGGTCAGGCTGG + Intronic
932574771 2:72956516-72956538 AGGTGTGGGTGGGCTGGGGAGGG + Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932769370 2:74492074-74492096 CAGGGAGGGTGGGGTGAGGACGG - Intronic
933076310 2:77931716-77931738 CTGTGTGGGTTGGGTGATCATGG - Intergenic
933648289 2:84829796-84829818 CTGTGTGTGAGGGGTGTGTGTGG - Intronic
933994522 2:87658207-87658229 CTGTGCAGGTAGGGTGTGGAGGG - Intergenic
934503219 2:94874553-94874575 CGGGGTGGGTAGGGTGTGGGGGG + Intronic
934584069 2:95474218-95474240 GTGTGTGGGTGTGGGGTGTATGG - Intergenic
934595383 2:95602496-95602518 GTGTGTGGGTGTGGGGTGTATGG + Intergenic
934768606 2:96894401-96894423 GTGAGTGGGTGGGGGGTGGGAGG - Intronic
934787388 2:97023038-97023060 GTGTGTGGGTGTGGGGTGTATGG - Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936299336 2:111292706-111292728 CTGCGCAGGTAGGGTGTGGAGGG + Intergenic
936573103 2:113632782-113632804 CTGTGTGGCTGTGGAGTGAAAGG + Intronic
936985489 2:118308521-118308543 CTGTTTGTGTGGGCTGGGGAAGG + Intergenic
937100328 2:119263729-119263751 TTGTGGGGGTGGGGTGGGCAGGG - Exonic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937263641 2:120602093-120602115 GGGTGTGGCTGGGGTGTGGAGGG - Intergenic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
937347065 2:121132601-121132623 CTGTGGGGGTTGGGGGTGCAGGG + Intergenic
937347347 2:121134469-121134491 ATGTGTGTGTGGTGTGTGGGGGG + Intergenic
937895955 2:126976990-126977012 CTGGCTGGGTGGGGTGTGTGGGG - Intergenic
937910404 2:127073014-127073036 CTGTGGGGGGGAGGTGGGGACGG - Intronic
938081651 2:128373450-128373472 GTGTGTGTGTGGGGTGGGGGTGG - Intergenic
938102126 2:128504439-128504461 GTGTGTGGGGGGGGCGGGGAGGG + Intergenic
938118722 2:128619487-128619509 CTGTGTGGGAAGGCTGTGGCAGG + Intergenic
938135955 2:128756649-128756671 GTGTGTGGGTGTGGTGTGGATGG + Intergenic
938629365 2:133149437-133149459 TGGTGGGGGTGGGGTGGGGATGG - Intronic
938950772 2:136252337-136252359 GTGTGTGTGTGGGCTGGGGAGGG + Intergenic
939070882 2:137540608-137540630 CTGTGTGAGTGGGGTGTTCCAGG - Intronic
940153973 2:150633461-150633483 TTGGGTGGGTGGGGAGTAGAGGG - Intergenic
940352818 2:152707733-152707755 CTGTCTTGGCGGGGTGTGGGGGG - Intronic
940772246 2:157851910-157851932 CTGGGCGGGTGGGGTGGGGGTGG - Intronic
941026859 2:160465833-160465855 GTGTGTGTGTGGTGTGGGGAGGG - Intronic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
941225144 2:162838827-162838849 CTGTGGGGGTGGGGTGGGAAGGG + Intergenic
943482856 2:188443186-188443208 CTGTGGGGGTGGGGGTTGGCGGG + Intronic
943666670 2:190616172-190616194 ATGTGTGGATGGAGTGAGGAGGG + Intergenic
944260372 2:197669532-197669554 AGATGTGGGTGGGGAGTGGACGG + Intronic
944675365 2:202031079-202031101 CTTTGGGAGTTGGGTGTGGAAGG + Intergenic
944876931 2:203971929-203971951 GGCTTTGGGTGGGGTGTGGATGG + Intergenic
945208999 2:207363127-207363149 CTGTGGGGGTGAAGTGGGGAGGG - Intergenic
945746314 2:213723239-213723261 CTGTGTGGATGGCATGTGGCTGG + Intronic
945800052 2:214417677-214417699 ATGTGTCGGTGGAGAGTGGATGG + Intronic
945842052 2:214898964-214898986 GTGTGTGGGTGGGTAGGGGAGGG - Intergenic
946104723 2:217359035-217359057 ATGTGTGGGTGGTGTGTGTGAGG - Intronic
946164992 2:217858386-217858408 CTGTGCTGGGAGGGTGTGGAGGG - Intronic
946177350 2:217929691-217929713 CGGGGCGGGTGGGGGGTGGAGGG - Intronic
946187614 2:217989956-217989978 GTGTGTGGCTGGTGTGTGGATGG - Intronic
946187638 2:217990118-217990140 GTCTGTGGCTGGTGTGTGGATGG - Intronic
946187662 2:217990291-217990313 GTGTGTTGCTGGTGTGTGGATGG - Intronic
946378225 2:219327170-219327192 CAGTGTGGCTGGGATGTGGCTGG + Intergenic
946455282 2:219820637-219820659 GTGTATGGGCGGGGTTTGGAGGG + Intergenic
946894696 2:224311444-224311466 GTGTGTAGCTGGGGTGTGGCTGG - Intergenic
946966151 2:225040534-225040556 GTGTGTGTGTGTGGTGTAGAAGG + Intronic
947017537 2:225638180-225638202 GTGTGTGTGTGTGGTGTGGGAGG + Intronic
947049886 2:226030642-226030664 CTGTGTGTGGGGGGTGGGGTGGG + Intergenic
947110644 2:226715652-226715674 GTGTGTAGGTGGGGTGTGTGTGG + Intergenic
947110669 2:226715831-226715853 GTGTGTGTATGGGGTGTGTATGG + Intergenic
947190255 2:227497166-227497188 TTGTGTGTGTGGGGTGGGGGGGG - Intronic
947217621 2:227763647-227763669 GGGTGGGGGTGGGGTGGGGAAGG + Intergenic
947318394 2:228889932-228889954 CTGTGTGGGCTGTGTCTGGAGGG - Intronic
947613120 2:231536122-231536144 CTGCATGGGTGGGGTGAGCATGG + Intergenic
947712968 2:232326282-232326304 CAGGGTGGGTGGGGTAGGGAAGG - Intronic
947732338 2:232438388-232438410 CTGTCTGGGGGAGGGGTGGAGGG - Intergenic
947732651 2:232439738-232439760 CAGGGTGGGTGGGGTAGGGAAGG - Intergenic
947749649 2:232525610-232525632 GTGTGTGGGTGGGATGGGGTGGG + Exonic
947994302 2:234514214-234514236 CTGTATGTGTGTGGTGTGGGGGG + Intergenic
947995762 2:234525902-234525924 GTGTGTGGGTGGGATGGGGGTGG - Intergenic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948276343 2:236711904-236711926 GTGTGTGTGTGTGGTGTGTAGGG - Intergenic
948313417 2:237007789-237007811 GTGTGTGGCTGGGGTGGAGAGGG + Intergenic
948556423 2:238814392-238814414 GGCTGTGGGTGGGTTGTGGAAGG - Intergenic
948563635 2:238870113-238870135 GTGTGTGTGTGGGGGGTGTATGG - Intronic
948563693 2:238870382-238870404 ATGTGTGTGTGGGGTGTGTGGGG - Intronic
948563785 2:238870901-238870923 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948563805 2:238870972-238870994 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948563924 2:238871549-238871571 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948576658 2:238956080-238956102 CTGGGTGGATGGGGTGTCCAAGG - Intergenic
948609775 2:239159482-239159504 GTGGGTGTGTGGGGTGTGGGTGG - Intronic
948657689 2:239486900-239486922 GTGTGTGCGTGGGGTGTGGGAGG + Intergenic
948720801 2:239898932-239898954 GTGTGACGGAGGGGTGTGGAGGG + Intronic
948720870 2:239899196-239899218 GTGTGATGGAGGGGTGTGGAGGG + Intronic
948720918 2:239899362-239899384 GTGTGATGGAGGGGTGTGGAGGG + Intronic
948791889 2:240383503-240383525 CTGTGTGGATGGGGAGTGGCAGG - Intergenic
1168957555 20:1845006-1845028 CTCTGTGTGTTGGTTGTGGAAGG + Intergenic
1169391170 20:5192340-5192362 TGGTGGGGGTGGGGTGGGGAAGG + Exonic
1169859049 20:10132604-10132626 CTGTGGGGGTGGTGTGGGGGAGG - Intergenic
1170233129 20:14072254-14072276 GTGTGTGTATGGGGTGTGGTGGG + Intronic
1170549397 20:17463659-17463681 GTGTGTGTGTGGGGGGTGGGGGG - Intronic
1171428966 20:25067169-25067191 GTGTGTGTGTGTGGTGTGGGGGG - Intergenic
1171849204 20:30296070-30296092 CTGGGTGGTTGGGGAGTGGGAGG - Intergenic
1172110011 20:32539019-32539041 CAGTGGGGGTGGGGTGGGGTGGG + Intronic
1172506572 20:35467157-35467179 CTGTGGGGGTGGGGTGGGTGGGG + Intronic
1172650798 20:36500178-36500200 TTCTGTGGGTAGGGGGTGGATGG - Exonic
1172782776 20:37447135-37447157 CAGTGTGTGTGGTGTGTGAAAGG + Intergenic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1172944089 20:38674552-38674574 CTCTGGGGGCGGGGTGGGGACGG - Intergenic
1173092443 20:39986029-39986051 GTGTGTGTGTGTGGTGTGTAGGG - Intergenic
1173125200 20:40330149-40330171 CTGAGTGAGTGGGTTGGGGAGGG + Intergenic
1173192721 20:40888266-40888288 TTGTGGGGGGGGGGTGTGGGCGG + Intergenic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1174083701 20:47989671-47989693 CTGTGCAGGTGATGTGTGGAGGG - Intergenic
1174272147 20:49377507-49377529 CTGAGTGGGTGGGGTGATGTGGG - Intronic
1174306850 20:49619429-49619451 ATGGGTGGGTGGGGGATGGATGG + Intergenic
1174306881 20:49619577-49619599 ATGTGTGGGTGGGGGATGGATGG + Intergenic
1174575945 20:51537245-51537267 ATGTGTGGGTGGGGGGTGCAGGG + Intronic
1174618575 20:51856020-51856042 CAGTGGGGGTGGGGTCTGCAAGG + Intergenic
1175720474 20:61283629-61283651 GTGTGTGTGTGGTGAGTGGATGG + Intronic
1175793189 20:61755288-61755310 CTGTGTGTGTGGTGTGTGTGGGG - Intronic
1175819027 20:61898585-61898607 GTGTGTGGATGGGGTGGGGGTGG - Intronic
1176057870 20:63158343-63158365 GGGGGTGGGTGGGTTGTGGATGG + Intergenic
1176057891 20:63158407-63158429 GATGGTGGGTGGGGTGTGGATGG + Intergenic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1176200707 20:63859014-63859036 GTGTGTGGGTGGGTTGTTGTGGG + Intergenic
1176622814 21:9070637-9070659 CGGGGTGGGTAGGGTGTGGGTGG - Intergenic
1176739210 21:10583718-10583740 CTATGTGTGTGGTGTGAGGAAGG + Intronic
1177512965 21:22113999-22114021 CTGTGGGGGTTGGGTGGTGAGGG + Intergenic
1177702230 21:24653947-24653969 CTCTGGGGATGGGGTCTGGAAGG + Intergenic
1177721373 21:24910928-24910950 ATGTGTGTGTGTGGTGGGGAGGG - Intergenic
1178074610 21:29003188-29003210 CTGGGGGGGTGGGGTGGGGCGGG + Intergenic
1178154363 21:29833756-29833778 GTGTGTGTGTGGTGTGTGTATGG - Intronic
1178289445 21:31354464-31354486 TCGTGTGGTGGGGGTGTGGAGGG - Intronic
1178510301 21:33199694-33199716 CTGTGAGGCTGGGCTGGGGATGG - Intergenic
1178599756 21:33985471-33985493 GTGTGTGGGTGGTGTGTGTGTGG - Intergenic
1178728975 21:35081613-35081635 ATCTGTGGGTGGGGTGAGGTGGG - Intronic
1178753531 21:35326327-35326349 CAGTGTGGGGCAGGTGTGGAGGG + Intronic
1178823276 21:35994227-35994249 GTGTGTGAGTGGGGTGTGTGAGG - Intronic
1179180651 21:39041987-39042009 ATGTGTGTGTGTGGTGTGAAGGG - Intergenic
1179231877 21:39511403-39511425 GTGTCTGGGTGGTGTGTGGGGGG + Intronic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1179504176 21:41829063-41829085 GTGTGTGTGTGGTGTGTGTATGG - Intronic
1179532203 21:42027545-42027567 GTGTGTGTGTGTGGTGTGGGGGG + Intergenic
1179543706 21:42100773-42100795 CAGGGTTGGTGGGGTGGGGAGGG - Intronic
1179543734 21:42100841-42100863 CGGGGTTGGTGGGGTGGGGAGGG - Intronic
1179543749 21:42100875-42100897 CGGGGTTGGTGGGGTGGGGAGGG - Intronic
1179620990 21:42616155-42616177 ATGTGTGTGTGGTGTGTGTATGG - Intergenic
1179751061 21:43467975-43467997 GTGTGTGGGTGTGGTGTGTGTGG - Intergenic
1179769582 21:43604542-43604564 CAATGTGTGTGGGGTGTGTATGG - Intronic
1179921966 21:44512333-44512355 CTGTGGGGGTGGGGTGGGGTGGG + Intronic
1180026216 21:45163711-45163733 CTATGGGAGTCGGGTGTGGACGG + Intronic
1180086744 21:45510976-45510998 TTGTGTGTGTGGGGTGTGGGGGG - Intronic
1180141994 21:45898557-45898579 CTGTGAGGATGGCGTGTAGAGGG - Intronic
1180146097 21:45919865-45919887 GTGTGTGGCAGGGGTGTGGGGGG + Intronic
1180256551 21:46633747-46633769 GTGTGTGTGTGTGGTGGGGAGGG + Intergenic
1180779386 22:18511601-18511623 GTGAGTGTGTGGGGTGTGGGTGG - Intergenic
1180842474 22:18965781-18965803 AGGAGTGGGTGGGGAGTGGAAGG - Intergenic
1180999414 22:19981142-19981164 CTCTGTAGTTGGGGGGTGGAGGG + Intronic
1181059012 22:20273075-20273097 AGGAGTGGGTGGGGAGTGGAAGG + Intronic
1181177043 22:21043832-21043854 TGGTGTGGGAGGGGTGTGGTGGG - Intergenic
1181475392 22:23164892-23164914 CTGTGGGGGTGGGGTGGGCTGGG - Intergenic
1181478648 22:23183543-23183565 CTATGTGGGGGCGGGGTGGAAGG + Intronic
1182072385 22:27472912-27472934 GTGTGTGGGTGCGGTGGGGGTGG - Intergenic
1182171653 22:28236124-28236146 TTGTGAAGGTGGTGTGTGGAGGG - Intronic
1182243163 22:28933715-28933737 GTGTGTGGGGGGGGTGGGGTGGG - Intronic
1182740032 22:32561027-32561049 ATTTGTGGGTGGGCTGAGGAGGG - Intronic
1182856197 22:33519552-33519574 CAGTGTGGGTGGGGAGTGTCTGG - Intronic
1183062164 22:35342874-35342896 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183062217 22:35343213-35343235 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183062228 22:35343291-35343313 GTGTGTAGGTGTGGTGTGTAGGG - Intronic
1183062248 22:35343408-35343430 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183062270 22:35343596-35343618 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183317788 22:37146381-37146403 CTGTGAGGGCAGGGTCTGGAAGG - Intronic
1183478511 22:38050305-38050327 CTCTGAGGGAGGGGTGGGGATGG + Intergenic
1183582381 22:38733652-38733674 CTGTGATGGTGGGATGGGGATGG + Intronic
1183730809 22:39617469-39617491 CTGTGGGGGTGGGGCATGGTGGG + Intronic
1184045401 22:41969729-41969751 TGGTGGGGGTGGGGTGGGGAAGG + Intergenic
1184226126 22:43129779-43129801 CTGTGTTGGTGGGGAGGGCAGGG + Intergenic
1184233676 22:43171745-43171767 CAGTGTGGGCGGGGTGGGGTCGG + Intronic
1184365242 22:44046957-44046979 CGGTGTGCGGGGGGTGGGGATGG + Intronic
1184432700 22:44450627-44450649 CTCTGAGGGTGGGGTCGGGATGG + Intergenic
1184565836 22:45291381-45291403 ATGTGTGTGTGGTGTGTGGGTGG + Intronic
1184800295 22:46754892-46754914 CAGTGGGGGTGGGGAGGGGATGG - Intergenic
1184834795 22:47014781-47014803 GTGTGTGGGGTGGGTGTGGTGGG + Intronic
1184880640 22:47302278-47302300 CACTGTGGCTTGGGTGTGGAGGG + Intergenic
1185056723 22:48583415-48583437 CTGTGTGTGTGGTGTGTGTGTGG - Intronic
1185069077 22:48646513-48646535 CTCTGTGGGTGGGCTCTGGGTGG + Intronic
1185119336 22:48956476-48956498 ATGTGTGTGTGTGGTGTGTATGG - Intergenic
1185134963 22:49064541-49064563 CTCAGTGGGAGGGGTGTGGTTGG - Intergenic
1185193399 22:49452920-49452942 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185193489 22:49453397-49453419 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185281858 22:49973571-49973593 GTGTGTGTATGGGGTGTGTATGG + Intergenic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
1185332653 22:50258628-50258650 CTGTTTGGTTGGGGTGAAGAGGG - Intronic
1185350949 22:50337826-50337848 GTGTGTGTGTGGGGTGTGTGTGG + Intergenic
1185427082 22:50778092-50778114 CTGTGTGGCTGTGGAGTGAAAGG - Intronic
949845238 3:8362970-8362992 CTATGTGGGTGGTGTGTGGTAGG + Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950668028 3:14509121-14509143 CTGGGCGGGTGGGGAGAGGATGG - Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950880171 3:16316967-16316989 CTGTGTGGGGTGGGTGTGGAGGG - Exonic
951118127 3:18889686-18889708 GTGTGTGTGTGTGTTGTGGAGGG + Intergenic
951325411 3:21296896-21296918 CTGCCTGGGTGTGGAGTGGAGGG - Intergenic
951425387 3:22538583-22538605 GTGTGTGTGTGTGGTGTGGGGGG - Intergenic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
952228047 3:31399433-31399455 CAGTGTAGTTGGGGTGTGAATGG - Intergenic
952441414 3:33333759-33333781 ATGGGTTGGTGGGGTGGGGAAGG - Intronic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
953152069 3:40333787-40333809 CTGTGTAGTTGGGGCGGGGAGGG - Intergenic
953220177 3:40962857-40962879 ATGTGTGGGTGGGGTTTGGGAGG - Intergenic
953331982 3:42061328-42061350 GTGGGGGGGTGGGGTGTGCATGG - Intronic
953688678 3:45098591-45098613 GTGGGGGTGTGGGGTGTGGAGGG - Intronic
953742233 3:45547770-45547792 CAGTGTGGGTGGGGGGTGAGGGG - Exonic
953743166 3:45554301-45554323 GTGTGTGGGGGGGGTGGGGTGGG - Intergenic
954038083 3:47863928-47863950 GTGTGTGTGTGGGGAGTGGTGGG + Intronic
954321477 3:49834710-49834732 CTATGTGGGTAGGGTTTGGGGGG - Intronic
954400208 3:50315528-50315550 CTCTGTGTGTTGGGTGTGGGTGG + Intergenic
954554902 3:51509989-51510011 GTGTGTGTGTGGGATGTGTATGG - Intergenic
955089165 3:55732328-55732350 TTTGGTGGGTGGGGTGAGGAAGG + Intronic
955347603 3:58172643-58172665 TTGTGGGGGTGGGGTGGGGCTGG + Intergenic
956322374 3:68011119-68011141 GTGTGTGTGTGGGGGGTGGTGGG + Intronic
956638441 3:71390563-71390585 GTGTGTGTGTGTGGTGGGGAGGG + Intronic
956681847 3:71788342-71788364 GTGTGTGGGGGGGGTGGGGTGGG - Intergenic
958711678 3:97724440-97724462 ATGTGTATGTGGGGTGGGGATGG + Intronic
959063051 3:101633253-101633275 CTGTGTGAGTGTGTTGTGAATGG + Intergenic
960904539 3:122586707-122586729 GTGTGGGGGTGGGGTGTGAGGGG - Intronic
961388761 3:126539526-126539548 CGGTGTGTGTGGTGTGTGCATGG - Intronic
961516407 3:127440205-127440227 ATGTGGGGGTGGGGTGGGGAAGG - Intergenic
961790233 3:129370876-129370898 GTGTGTGTGTGGTGTGTGTATGG + Intergenic
961901528 3:130217609-130217631 GTGTGTGTGTGTGGTGTGAAGGG - Intergenic
962058490 3:131900045-131900067 CTGGGTAGGTGGAGTGGGGAGGG + Intronic
962149960 3:132882063-132882085 GTGTGTGTGTGGTGTGTGTATGG + Intergenic
962150053 3:132882946-132882968 CTGTTGGGGTGAGGTGGGGATGG + Intergenic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962323160 3:134407683-134407705 ATGTGTGGGTGAGGGGAGGAAGG - Intergenic
962438731 3:135392196-135392218 CTGACTGTGTGGGATGTGGAAGG + Intergenic
962755179 3:138460866-138460888 GTGTGTGTGTGTGGTGTGGGCGG - Intronic
962874358 3:139524534-139524556 CTGTGGGGGTGGGGTGAACATGG + Intronic
962924451 3:139978692-139978714 GTGTGTGTGTGTTGTGTGGAAGG + Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
963603755 3:147397408-147397430 CTGTGGGGGTGGGGTGAGGGAGG - Intronic
963727354 3:148937379-148937401 CTGGGTGGGTGGAGTGGGGTGGG - Intergenic
963809760 3:149764321-149764343 CTTTGTTGGTGGGCTGTGGAAGG - Intronic
965367045 3:167813883-167813905 CTGTGTGGCTGCAGTGGGGAGGG - Intronic
965381000 3:167987811-167987833 CACTGGGGGTGGGGTGGGGATGG + Intergenic
965465004 3:169018283-169018305 GTGTGTGTGTGGGGTGGGGGTGG - Intergenic
965590533 3:170357266-170357288 CGGTGAGGGTGGGGTGGGGAGGG + Intergenic
966206011 3:177407248-177407270 GTTTGTGTGTGGGGTGGGGAGGG + Intergenic
966212793 3:177470245-177470267 GGGTGGGGGTAGGGTGTGGATGG + Intergenic
966402378 3:179561448-179561470 TTTTGTGTGTGGGGTGGGGAGGG - Intergenic
966625068 3:182006878-182006900 ATGTGTGTGTGGTATGTGGAGGG + Intergenic
966653140 3:182323662-182323684 CTGTGAGGGAGGTGTGTGGTAGG - Intergenic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
966892068 3:184414529-184414551 ATGTGTGTGTGGGGTGTGTGTGG + Intronic
967803425 3:193690309-193690331 GTGTGTGTGTGGGGTGGGGTGGG - Intronic
967807625 3:193729624-193729646 ATGTGTTGGTGGGGAGGGGAGGG - Intergenic
968090673 3:195896423-195896445 TGGTGTGCTTGGGGTGTGGAAGG - Intronic
968136490 3:196223509-196223531 CTGGGTTGGTGGCGTGTGAAAGG + Intronic
968229569 3:196997403-196997425 TTGTGAGGGTGGGGAGTGCAGGG + Intronic
968282729 3:197489410-197489432 GGGTGTGGGTGGGGAGTGAAAGG + Intergenic
968873594 4:3253882-3253904 CTGTGAGGGTGGGGTCTGTGTGG - Intronic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969059990 4:4426710-4426732 CGGTGAGGGTGGAATGTGGACGG - Intronic
969539905 4:7781787-7781809 GTGTGTGGGAGGGGGGTGGTGGG - Intronic
969563991 4:7966905-7966927 GTGTGTGGGAGGGGTGTGTGCGG + Exonic
969691598 4:8706947-8706969 GGGTGGGGGTGGGGTGTGCAAGG + Intergenic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
969841354 4:9885013-9885035 CTGTCTGGGGTGGGAGTGGAGGG + Intronic
969894497 4:10290829-10290851 GTGTGTGGGGGGGGTGGGGGTGG + Intergenic
970149669 4:13075655-13075677 CTGGGGGGGTGGGGTGCTGAGGG + Intergenic
970781201 4:19740080-19740102 CCAAGTGGGTGAGGTGTGGAAGG - Intergenic
970980861 4:22095417-22095439 GTGTGTGGGTGGAGTGGGGTAGG + Intergenic
972406779 4:38753752-38753774 CTGTGTGTATGGGGTGTGTGTGG - Intergenic
972686724 4:41360005-41360027 GTGTGTGGGTAGGGTGTGTAGGG + Intronic
973563551 4:52161688-52161710 CTGTATGTGTGGGGTTGGGATGG - Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973823581 4:54684167-54684189 GTGTGTGGGTGGGGTGGGGTGGG + Intronic
973845758 4:54911509-54911531 CTGTGTGGGTATGGTGGAGAAGG - Intergenic
973862283 4:55077631-55077653 GTGTGGGGGTGGTGTGTGGTGGG + Intergenic
973955520 4:56059502-56059524 CTGGCTGGGTGGAATGTGGATGG - Intergenic
974912362 4:68138017-68138039 ATGTGTGGGAGGGGTGAGGAAGG + Intergenic
975000590 4:69220441-69220463 CTGTGTGGGTGTGTTGGGGGTGG + Intergenic
975005180 4:69274758-69274780 CTGTGTGGGTGTGTTGGGGGTGG - Intergenic
975013591 4:69383741-69383763 CTGTGTGGGTGTGTTGGGGCTGG - Intronic
976141006 4:81991506-81991528 CAGTGGGGGTGGGGTGGGGTGGG + Intronic
976217875 4:82731722-82731744 CTCAGTGGGTGGGGTGTGATGGG - Intronic
976507802 4:85869518-85869540 CTGTTTGGATGGGGTGGGGGAGG + Intronic
976586402 4:86802167-86802189 GTGTGTGTGTGTGGTGTGTAAGG + Intronic
977214183 4:94259499-94259521 CTGTGTGGGAGGGGAGAGGTAGG + Intronic
977435766 4:96992392-96992414 GTGTGTGGGTGGGTGGGGGAAGG - Intergenic
977442706 4:97089550-97089572 GTGTGCGTGGGGGGTGTGGAAGG - Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977580036 4:98714805-98714827 GTGTGTGGATCGAGTGTGGAAGG - Intergenic
977987563 4:103401852-103401874 TTGTGTAGGTGGGGTGGGGTGGG + Intergenic
978629712 4:110730324-110730346 CTGTCGGGGTGGGGAGGGGAGGG - Intergenic
979561357 4:122105524-122105546 GAAAGTGGGTGGGGTGTGGATGG + Intergenic
980032495 4:127846328-127846350 CTGTGTGGCTGGGGTGGAGGAGG - Intergenic
980516484 4:133868895-133868917 ATGTGTGGATGTGGTGGGGAGGG + Intergenic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
982071403 4:151698369-151698391 ATTTGTGGGTGAGGTGTGCATGG + Intronic
982255024 4:153443211-153443233 TTTTGTGAGTGGGGAGTGGAGGG + Intergenic
982549174 4:156775867-156775889 CACTGTGTGTGGGGTGTGGTGGG - Intronic
982551934 4:156813040-156813062 ATGTGTGTGCGGGATGTGGAAGG + Intronic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
983518267 4:168679242-168679264 GTGTGTGTGTGGTGTGTGGTGGG + Intronic
983827649 4:172284388-172284410 TGGTGTGTGTGGGGGGTGGATGG - Intronic
983938552 4:173519486-173519508 CTGTGTGCGTGGGGAGGGGGCGG - Intergenic
984117444 4:175699642-175699664 ATGTATGTGTGGGGGGTGGAGGG + Intronic
984468835 4:180138764-180138786 GTGTGTGTGTGGGGTGGGGGTGG + Intergenic
985070198 4:186160001-186160023 TTGTGTGGGGGGTGTGTGGGGGG - Intronic
985390875 4:189490835-189490857 TGGTGTGGGTGGGCTGTGGCTGG + Intergenic
985564898 5:610701-610723 GTGTGTGGGAGGTGTGTGCAGGG - Intergenic
985622427 5:962590-962612 ATGTGATGGAGGGGTGTGGATGG + Intergenic
985635938 5:1035925-1035947 CTGGGTGGCTGGGGTGTGGCTGG + Intronic
985703672 5:1388487-1388509 ATGTGTGGGTAGGTTATGGACGG - Intergenic
985711344 5:1431536-1431558 CAGTGTGGGTTGGGTCTGGCCGG + Intronic
985711690 5:1433079-1433101 CTGAGTGGCTGTGGTGGGGATGG - Intronic
985713353 5:1442447-1442469 CTCTGTGGCTGGGTTCTGGAGGG + Intronic
985994847 5:3592244-3592266 CTGTGGGGGTGGGGGTTGGGCGG - Intergenic
986283092 5:6339366-6339388 GTGTGTGGGTGGGCAGTGGAGGG + Intergenic
986672467 5:10154902-10154924 CATTGTGGGTGGGAGGTGGAGGG - Intergenic
986727989 5:10613941-10613963 CAGGGTTGGTGGGGTGGGGAAGG - Intronic
986793065 5:11182082-11182104 ATGTGTGGGGTGTGTGTGGATGG + Intronic
987050712 5:14144618-14144640 CTGTGTGGGTGGCGTGGAGGTGG + Intronic
987385438 5:17324810-17324832 GTGTGTGTGTGTGGTGGGGAAGG - Intergenic
987471230 5:18331129-18331151 GTCTGTGGAGGGGGTGTGGAGGG - Intergenic
987682094 5:21149349-21149371 CAGTGTGGGAGGGGTGTGTTTGG + Intergenic
988427096 5:31076478-31076500 TGGTGGGGGTGGGGTGGGGAGGG - Intergenic
988528014 5:32003306-32003328 GTGTGTGTGTGGGGTGTGTGTGG - Intronic
988659743 5:33252438-33252460 GTGTGTGTGTGGGGTGGGGGGGG - Intergenic
988873737 5:35420227-35420249 CTGTGTGTGAAGGGTGTTGAGGG - Intergenic
989170975 5:38469967-38469989 CTTTGGGGGTGGGGAATGGAGGG + Intergenic
990168131 5:53017836-53017858 CAGTGTTGGGGGGATGTGGAGGG + Intronic
990331380 5:54729635-54729657 TTGTGGGGGTGGGGTGGGGGGGG - Intergenic
990352289 5:54930956-54930978 CTGTGTGGGTGTGGAGTCAAGGG - Intergenic
990442908 5:55864607-55864629 CTGTGTGTGTGTGGTGTGTATGG - Intronic
991401335 5:66254919-66254941 CAGCGTGGGTGGGGAATGGATGG - Intergenic
991470429 5:66963051-66963073 ATGGGTGGGTGGGGAGTGGGGGG + Intronic
991584185 5:68186092-68186114 GTGTGTGGGTGGGGTCCGGTTGG + Intergenic
992481765 5:77158609-77158631 CTGGGTGGGTGGCCTGTGGGTGG + Intergenic
992862580 5:80927355-80927377 GTGGGTGGGTGGGGTGGGGGTGG - Intergenic
993280224 5:85916529-85916551 GGGTGGGGGTGGGGAGTGGAGGG - Intergenic
993457382 5:88141758-88141780 CTGTGTGTGGGGGGTGGGGGCGG - Intergenic
993536038 5:89087674-89087696 CTGTGTTGATGGGGTGGGGAAGG - Intergenic
993828351 5:92721961-92721983 GTGTGTGTGTGGGGGGTGGGGGG - Intergenic
993881196 5:93363418-93363440 CACTGGGGGTGGGGTGGGGATGG + Intergenic
993885158 5:93407570-93407592 GGGTGGGGGTGGGGTGAGGAGGG - Intergenic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
994136366 5:96291874-96291896 GTGTGTGTGTGTGGTGGGGAAGG + Intergenic
995326857 5:110899424-110899446 TTTTGTGGGTGGGGTGGGGTGGG + Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
995847783 5:116512693-116512715 CTGTGTGTTTGGGGTGGGGGTGG - Intronic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
996360622 5:122641445-122641467 ATGTGTGTGTGGGGAGGGGAGGG - Intergenic
996374420 5:122789420-122789442 ATGTGTGTGTGTGGTGGGGAAGG - Intronic
996385396 5:122905160-122905182 TTTTGTGGGTGGGGTGTTGAGGG + Intronic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
996876279 5:128243683-128243705 ATGGGTGGGTGGGTGGTGGATGG + Intergenic
997085477 5:130792561-130792583 CTGGGTGGGTGGAGTGGGTATGG + Intergenic
997250828 5:132387290-132387312 GTGTGGGGGTGGGGAGTGGGGGG - Intronic
997335528 5:133106527-133106549 ATGTGTGTGTGGGGTGGGGGCGG + Intergenic
998149389 5:139748186-139748208 CTGGGTAGGTGGGGTGGGGGCGG - Intergenic
998164443 5:139834998-139835020 CTGTGTGGGTGACGGGTGAATGG - Intronic
998238712 5:140423001-140423023 CTGCAGGGGTGGGGTGTGGAAGG - Intronic
998402797 5:141856653-141856675 CTGTCTGGGAGGGATTTGGAGGG - Intronic
998819179 5:146042852-146042874 GTGTGCGGGTGTGGTGGGGAAGG - Intronic
999178986 5:149655473-149655495 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
999189925 5:149739680-149739702 CTGAGTGGCTGGGCTTTGGATGG + Intronic
999270484 5:150293987-150294009 ATATGTGTGTGGGCTGTGGAAGG - Intergenic
999843366 5:155452581-155452603 CAGTGGGGGTGGGGTCTGGGGGG - Intergenic
1000067187 5:157704660-157704682 GTGTGTGTGTGTGGTGGGGAAGG + Intergenic
1000109620 5:158095309-158095331 GTGTATGGGTTGGGAGTGGAAGG + Intergenic
1000367411 5:160504612-160504634 GTGTGTGTGTGGGGTGTGAGAGG + Intergenic
1000367438 5:160504791-160504813 GTCTGTGTGTGGGGTGTGAAGGG + Intergenic
1000367457 5:160504933-160504955 CTGTATGTGTGGGGTGTGAGGGG + Intergenic
1000367475 5:160505065-160505087 ATGTGTGTGTGGGGTGTGTGTGG + Intergenic
1000367490 5:160505155-160505177 GTGTGTGTGTGGGGTATGTATGG + Intergenic
1000367498 5:160505201-160505223 ATGTGTGTGTGGGGTATGTATGG + Intergenic
1000367628 5:160505934-160505956 ATGTGTGGGGGGGGTATGTATGG - Intergenic
1000605880 5:163327100-163327122 CCATGAGGGTGGGGTGAGGAGGG - Intergenic
1001018918 5:168166094-168166116 TTGTTTGGTTGGGGTGGGGATGG + Intronic
1001086979 5:168707567-168707589 CTCTGAGGGTGGGGTTTGGCAGG + Intronic
1001438291 5:171718164-171718186 AGGTGGGGGAGGGGTGTGGAGGG - Intergenic
1001550168 5:172596834-172596856 GTGTGTGTGTGGGGTGTGTGTGG - Intergenic
1001579819 5:172790952-172790974 CAGTGGGGGTGGGGGATGGAGGG - Intergenic
1001654764 5:173340886-173340908 CCCTGTGGGTAGGGTGGGGAGGG + Intergenic
1001774018 5:174315325-174315347 CTGTGTGGGAAGGGTGTGCCGGG + Intergenic
1001845584 5:174918091-174918113 CAGGGTGTGTGGGGTGGGGAGGG + Intergenic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002172946 5:177385567-177385589 GTGTGTGTGTGTGGTGAGGATGG + Intronic
1002346000 5:178547774-178547796 GTGTGTGGGGGGTGTGTGGGGGG - Intronic
1002394955 5:178945520-178945542 CTGTGTGGGGGGTGTGGGTATGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002458405 5:179359546-179359568 GGGTGTGTGTGAGGTGTGGAAGG - Intergenic
1002589808 5:180282730-180282752 CTGTGTTGCTGGTGTGTTGACGG - Intronic
1002858360 6:1057724-1057746 CTTACTGGGTGGGATGTGGAAGG - Intergenic
1002862774 6:1094945-1094967 GTGTGTGCCGGGGGTGTGGAGGG - Intergenic
1003445998 6:6184868-6184890 GTGTTGGGGTGGGATGTGGAGGG + Intronic
1004050144 6:12069374-12069396 GTGAGTGGGTGGTGAGTGGATGG + Intronic
1004161881 6:13221425-13221447 CTGGGTGGGTGGGGAGGGGGAGG + Intronic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1004413170 6:15400471-15400493 CTGTGGGGGTGGGGTGTGCTTGG + Intronic
1004900827 6:20192405-20192427 GGGTGTGGGTGGTGTTTGGAAGG - Intronic
1004971996 6:20921091-20921113 CTGGCTGGCTGGGGTGTGTACGG - Intronic
1005135007 6:22557788-22557810 CTGAATGGGTGGGGTGAGGTGGG + Intergenic
1005206317 6:23409498-23409520 CTGTGTGGAAGGTGTGTGGGTGG - Intergenic
1005523199 6:26618710-26618732 TTTTTTGGGTGGGGGGTGGAGGG - Intergenic
1005559256 6:27020842-27020864 CTGATTGGGAGGGGTGTGGGGGG + Intergenic
1006042281 6:31266543-31266565 GTGAGTGGGTGGGGTGGGGTGGG - Intergenic
1006102224 6:31692743-31692765 CAGTGGGGGTGGGGTGGGGGTGG - Intronic
1006118814 6:31791823-31791845 CAGAGTGGGTGGGGTGGGGAAGG - Intronic
1006391702 6:33762393-33762415 CTGTGTGGGGAGGGTGTGCGAGG - Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006509348 6:34513517-34513539 CAGTGTGGGTGGTGGGTGGCAGG - Intronic
1006613570 6:35310258-35310280 GGGTGTGGGTGTGTTGTGGAGGG + Intronic
1006804099 6:36777357-36777379 CTGTGTAGGATGGGTGGGGAGGG - Intronic
1007110235 6:39309454-39309476 CTGTGTGTGTGGGGTGGGGCAGG + Intronic
1007274444 6:40663053-40663075 ATGTGGAGGTGGGGTCTGGAGGG - Intergenic
1007417786 6:41702212-41702234 ATCTGTGGGTGGGGTCTGGGAGG - Intronic
1007469477 6:42079169-42079191 GGGTGAGGGTGGGGTGTTGAGGG + Exonic
1007623001 6:43226207-43226229 CGGTGTGGCTGTGGTGAGGAGGG + Intronic
1007696683 6:43738151-43738173 CTGTGTGTGTGTGGTGTGTGTGG + Intergenic
1007769537 6:44181434-44181456 GTGTGTGAGTGTGGTGTGGTTGG - Intronic
1007772244 6:44201301-44201323 CAGTGTGGGTGGGGAATGGGCGG - Intergenic
1008608812 6:53167055-53167077 TTATGGGGGTGGGGTGGGGATGG - Intergenic
1008883882 6:56410933-56410955 ATGTGTGTGTGGGGTGGGGGGGG - Intergenic
1009711343 6:67325504-67325526 GTGTGTGTGTGGGGTGGGGGGGG + Intergenic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1011119237 6:83932580-83932602 CCTTGTGGGAGGGGTGTGGCTGG - Intronic
1011344163 6:86350734-86350756 CTGTGTGTGTGTGGTGCGGGTGG - Intergenic
1011821228 6:91255911-91255933 CTGTGCTGGGGTGGTGTGGAAGG + Intergenic
1013180871 6:107715991-107716013 GTGGGAGGGTGGGGTGTGGGGGG + Intronic
1013520027 6:110924279-110924301 ATGTGGGGGTGGGGTGGGGGAGG + Intergenic
1013608737 6:111774560-111774582 GTGTGTGGGGGGGATGGGGAGGG - Intronic
1013878212 6:114860610-114860632 GTGTGTGGTGGGGGTGTGGAGGG + Intergenic
1013992043 6:116265159-116265181 CTGCAGGGGTGGGGAGTGGAAGG + Intronic
1014250231 6:119108139-119108161 GTGTGTGTGTGTGGTGTGTAGGG + Intronic
1014911925 6:127104855-127104877 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016146523 6:140683607-140683629 CTATGTGTGTGGGGTTGGGAAGG + Intergenic
1016177599 6:141099313-141099335 CTGTGGGGGTGGGGTGCGCATGG + Intergenic
1016312755 6:142751914-142751936 CTCTGAGGGTTGGGTGTGGAAGG - Exonic
1016467167 6:144337100-144337122 CTGTGTGTGTTGTGTGTGGCAGG - Intronic
1016635324 6:146282543-146282565 TTTTTTTGGTGGGGTGTGGAGGG - Intronic
1016724172 6:147341677-147341699 GTGTGTGGGTGTGTTGTGGGTGG + Intronic
1016985069 6:149888975-149888997 CTGTGTGGGGAAGGTGGGGAAGG + Intronic
1017048969 6:150372630-150372652 GTGTATGGGTGGGGTGGGGGTGG + Intronic
1017048994 6:150372758-150372780 GTGTGTGGGTGGGGTGGGGGTGG + Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017460715 6:154646806-154646828 GTGTGGGGGTAGGGAGTGGAGGG + Intergenic
1017497225 6:154993620-154993642 TTTTGTGGGTGGGGTGGGGGGGG - Intronic
1018123824 6:160662644-160662666 CTGTGTGTGTAGGGAGTGCAGGG - Intronic
1018459577 6:163985163-163985185 ATGTGTTGGAGGGGTGTGAAGGG - Intergenic
1018463104 6:164017781-164017803 GGGTTTGGGTGTGGTGTGGAAGG - Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018910979 6:168100928-168100950 GGGTGAGGGTGGGGTGGGGAAGG + Intergenic
1018962080 6:168456316-168456338 CAGGGTGGGTGGGGCGTGGAGGG + Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019291796 7:254127-254149 CCGGGTGCGTGGGGTGTGGTGGG + Intronic
1019365832 7:632388-632410 CTGTGTTGGGGGGCAGTGGATGG - Intronic
1019516581 7:1442833-1442855 CTGGGTGGGTGGTGTGTTTAGGG - Intronic
1019523744 7:1471694-1471716 CTGGGTGGCTGGGGTGGGGTGGG - Intronic
1019552046 7:1608059-1608081 CTGTGTGTGCGAGGCGTGGAGGG + Intergenic
1019606406 7:1912386-1912408 CTGTTTGGGTGAGGTGAGGCAGG + Intronic
1020127013 7:5538751-5538773 GTGTGTGTGTGGGGTGTGTGTGG - Intronic
1020214525 7:6179654-6179676 GTGTGTGTGTGGGGTGTGTGTGG - Intronic
1020446559 7:8275047-8275069 ATGTGTGTGTGGGTTGTGGTGGG + Intergenic
1020899176 7:13982614-13982636 GTGTGTGGGCGGGGAGAGGATGG - Intronic
1022290753 7:29000356-29000378 GTGGGTGGGTGGGGTGGGGGTGG + Intronic
1022320871 7:29286438-29286460 ATGTGGGGATGGGGTGGGGAGGG + Intronic
1022514452 7:30966388-30966410 GTGTGTGTGTGGGGTGGGGGTGG + Intronic
1023177336 7:37447630-37447652 GTGTGTGGGGGGGGTGTTGTGGG - Intronic
1023255705 7:38310452-38310474 CTGGGTGAGTGTGGTGTGGTGGG + Intergenic
1023344795 7:39260381-39260403 CTGTGTGTGTGGTGTGAGCAAGG - Intronic
1023473654 7:40552760-40552782 CTGGGTGGTGGGGGTGGGGATGG - Intronic
1024237323 7:47408305-47408327 CGGTGTGGGTGGGACTTGGAAGG - Intronic
1024290709 7:47801534-47801556 CTGTGTGTGTAGACTGTGGACGG + Intronic
1024971803 7:55078297-55078319 CTGTGGCGGTGGGGTGGGGTGGG - Intronic
1025873125 7:65453624-65453646 CTGTTTGTGTGGCCTGTGGAGGG + Intergenic
1026236123 7:68528743-68528765 CTGGGTGGGAGGGGTCTGGGCGG + Intergenic
1026434158 7:70379580-70379602 CTGTGTGTGTAGGTTCTGGAAGG + Intronic
1026808180 7:73441000-73441022 CAGTGTCGGTGGGGGGTGGGAGG - Exonic
1026856324 7:73757572-73757594 CTTGGTGGCTGGGATGTGGAAGG + Intergenic
1026873162 7:73865435-73865457 GGGTGAGGCTGGGGTGTGGAGGG + Intronic
1027197581 7:76041352-76041374 GTGTAGGGGTGGGGTGAGGAGGG + Intronic
1027270274 7:76515119-76515141 CTCTCTGGGTGGGATGTGGTGGG - Exonic
1027455839 7:78390633-78390655 TGGTGGGGGTGGGGGGTGGAGGG + Intronic
1027522675 7:79229939-79229961 CTGTGAGGGTGGGGGGAGGGGGG - Intronic
1027557385 7:79682792-79682814 GTGTGTGTGTGGTGTGTGGAAGG + Intergenic
1027741894 7:82018981-82019003 CTGTCTTGGTGGGGTGGGGGTGG + Intronic
1027770407 7:82399677-82399699 CTGGGGGGGTGGGGAGTGGGAGG - Intronic
1028976437 7:96919767-96919789 ATGTATGGGTGGGGTGGGAAAGG + Intergenic
1029115246 7:98233352-98233374 CTGGGGGTGTGGGGTGTGGGAGG - Intronic
1030735034 7:113037797-113037819 TGGTATGGGTGGGGTGAGGAGGG + Intergenic
1031269709 7:119633082-119633104 CTTTCTGTGTGGGGTGAGGAGGG - Intergenic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031815787 7:126433442-126433464 CTGTGTGTGTTGGGAATGGAGGG + Intergenic
1032023364 7:128422137-128422159 CTGTGTTTGTGGTGTGTGGGGGG + Intergenic
1032400377 7:131620265-131620287 CTGGGTTGGTGGGCTGTGCAGGG - Intergenic
1032517537 7:132518360-132518382 CAGTGTGGGTGGGGCCTGGTGGG + Intronic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1032754686 7:134878067-134878089 CTCTGTGGGTGGGGAGGTGAAGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033437484 7:141346605-141346627 CAGTGTGTGTGGAGTGTGTATGG - Intronic
1033600813 7:142887201-142887223 GTGTGTGTGTGGCGTGTGTATGG + Intergenic
1033665938 7:143440465-143440487 GTGTTTGGGTGGGGAGTGGGTGG + Intergenic
1033943201 7:146681418-146681440 TCCTGTGGGTGGGGGGTGGAGGG + Intronic
1034162900 7:149005853-149005875 CTGCGGGGGTGGGGGGTGGGGGG - Intronic
1034213772 7:149387370-149387392 CTGTGGAGGTGGGGCGTGGCAGG - Intergenic
1034352638 7:150427413-150427435 GTGTGTGGGGGGGGCGTGGGGGG + Intergenic
1034535851 7:151725218-151725240 GTGTGTGGGTGGCGGGTGGCAGG - Intronic
1034572449 7:151967783-151967805 CTCTGAGGGTGGCGTGGGGACGG - Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034858249 7:154574213-154574235 CTGTGTGTGTGGCGTGTGTGTGG + Intronic
1034990177 7:155543041-155543063 CTCTGTGGGAGGGGTGAGGCGGG - Intergenic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035255408 7:157622702-157622724 CTGGGTGGGTGTGGTGGTGAGGG + Intronic
1035436591 7:158864072-158864094 GTGTGTGTGTGTGGTGTGGGGGG + Intronic
1035631521 8:1110446-1110468 CTGGGTCTGTGGGGTGTGCATGG + Intergenic
1035823510 8:2620151-2620173 CTGTGTGAGAGGGATGTGGGTGG + Intergenic
1035883131 8:3264841-3264863 ATGTGTGGGTGGGCTGTGTGTGG + Intronic
1035924006 8:3708080-3708102 TGGTGTGTGTGGGGTGTGCAAGG + Intronic
1036040693 8:5077088-5077110 GTGTGTGGGGGGGGTGGGGGGGG - Intergenic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036347059 8:7973388-7973410 ATGGGTGGGTGGGGTGTTCACGG - Intergenic
1036632188 8:10523808-10523830 TTCTGGGGGTAGGGTGTGGAGGG - Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036648260 8:10625506-10625528 GGGTGGGGGTGGGGTGTGGGAGG + Intronic
1036972543 8:13370889-13370911 CTGTGTGGCTGTGTTGTGGTGGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037887037 8:22600707-22600729 CTGTCTGGGAGATGTGTGGATGG - Intronic
1037911692 8:22747567-22747589 CAGGGTGAGTGGGGTGTGCATGG + Intronic
1038219610 8:25594793-25594815 GTGTGTGGGGGTGGTGGGGATGG + Intergenic
1038428045 8:27477912-27477934 GTGTGGGGGTGGGGTGGGGGTGG - Intronic
1038533824 8:28339590-28339612 GTGTGTGTGTGGAGTGGGGAGGG - Intronic
1038697692 8:29820593-29820615 ATGTGTGTGTGGTGTGTGTATGG - Intergenic
1039058674 8:33556459-33556481 CTGTGTGTGTGTGGTGGGCAGGG + Intronic
1039343347 8:36675081-36675103 CTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1039557741 8:38488726-38488748 GTGTGTGTGTGTGTTGTGGAGGG - Intergenic
1039755112 8:40514368-40514390 TTGTGGGGGAGGGGTGGGGAGGG + Intergenic
1039913727 8:41844506-41844528 GTGTGTGGGGGGTGTGTGGTGGG - Intronic
1039925827 8:41931568-41931590 GTGTGTGTGTGAGGAGTGGAGGG + Exonic
1040944973 8:52874471-52874493 CTTTGCTGGTGGGGTGTGGGTGG + Intergenic
1040948201 8:52907402-52907424 TTTTGGGGGTGGGGTGGGGACGG + Intergenic
1040978283 8:53217898-53217920 GTGTGTGGGGGGGGTGTGTGTGG + Intergenic
1041023873 8:53664983-53665005 CTGTGGGGGTGGGGTGGGGTAGG - Intergenic
1041207202 8:55511173-55511195 CTGTGTGTCTGGGGTGGGAAGGG - Intronic
1041254211 8:55965361-55965383 CTGGGTGGGGGAGGAGTGGAGGG + Intronic
1041700008 8:60778086-60778108 CTGGTGGGGTGGGGGGTGGAGGG + Intronic
1043007418 8:74836805-74836827 CTGCTTGGGTGGAGTGGGGATGG + Intronic
1043185248 8:77140088-77140110 CTTTGTGGGCGGGGGGTGGGGGG - Intergenic
1044434930 8:92150821-92150843 CTGTCTGGGGTGGGGGTGGAGGG + Intergenic
1044719269 8:95130094-95130116 CTGTGTGGCTCCTGTGTGGAGGG + Intergenic
1045038230 8:98194252-98194274 CTGGGTAGGCGGGGTGAGGAAGG + Intronic
1045065047 8:98437046-98437068 CTGTGTGTGAGGGGAGTGGAGGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1046739821 8:117816006-117816028 GTGTGTGTGTGGGGTGGGGAGGG + Intronic
1047498082 8:125422620-125422642 GTGTGTGTGTGGGGTGTGTGTGG + Intergenic
1047498098 8:125422686-125422708 GTGTGTGTGTGGGGTGTGTGTGG + Intergenic
1047498112 8:125422749-125422771 CTGTGTGTGTGGGGTGTGTGTGG + Intergenic
1047498118 8:125422773-125422795 GTGTGTGTGTGGGGTGTGTGTGG + Intergenic
1047498124 8:125422797-125422819 GTGTGTGTGTGGGGTGTGTGTGG + Intergenic
1047640640 8:126817955-126817977 CTGTCTGGGTGGGGTGGGGTGGG - Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048293064 8:133195188-133195210 GTGTGTGTGTGGTGTGTGTATGG + Intronic
1048346727 8:133581413-133581435 CAGTGGGGGTGGGTAGTGGAAGG + Intergenic
1048389506 8:133948152-133948174 CTGTGTGTATGGGGTGGGGGTGG + Intergenic
1049050886 8:140194259-140194281 GACTGTGGGTGGGGTGTGAAGGG - Intronic
1049162138 8:141104424-141104446 CTGTTTGGCTGGGGTCTTGAAGG - Intergenic
1049167073 8:141133120-141133142 CAGTGAGCGTGGGGGGTGGAGGG + Intronic
1049494608 8:142923910-142923932 CCTTGTGGGTGGGCTGAGGAGGG - Intergenic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049543205 8:143217984-143218006 GTGTGGGGGTGGTGTGGGGATGG - Intergenic
1049582327 8:143418331-143418353 GTGGGTGGGTGGGGGTTGGAGGG - Intergenic
1049708901 8:144054965-144054987 CGGGGTGGGGGGGGGGTGGAGGG + Intronic
1049717355 8:144099245-144099267 CGATGGGGGTGGGGTGTGGGAGG - Intronic
1049753067 8:144294787-144294809 CTGTGTGGGTGGGGTGCTCATGG - Intronic
1049844445 8:144793118-144793140 CTGTGCGGGAGAGGTGGGGAAGG + Intergenic
1049998503 9:1052209-1052231 CTGGGCGCGGGGGGTGTGGACGG - Intronic
1050009590 9:1172164-1172186 CTGGGTGGATGGGGAGAGGAAGG + Intergenic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1051221235 9:14850558-14850580 CTGTCGGGGTTGGGGGTGGAGGG + Intronic
1051852745 9:21528252-21528274 CTGTGCGGGGAGGGTGTGGGTGG + Intergenic
1052328875 9:27246950-27246972 GTGTGTGTGTGGGGTGGGGGGGG - Intergenic
1053273178 9:36763809-36763831 GTGTTTGTGTGGGGTGTGGGGGG + Intergenic
1053786925 9:41658789-41658811 CTGGGTGGTTGGGGAGTGGGAGG - Intergenic
1054158138 9:61655406-61655428 CTGGGTGGTTGGGGAGTGGGAGG + Intergenic
1054477911 9:65586411-65586433 CTGGGTGGTTGGGGAGTGGGAGG + Intergenic
1055024338 9:71703318-71703340 CTGTGTGGGTGGGGCACAGAGGG + Intronic
1055071082 9:72166409-72166431 ATGTGTGGGTGGGGTGGGGGTGG + Intronic
1055403596 9:75950139-75950161 GTGTGTGGGGGGGGCGGGGAGGG + Intronic
1055479876 9:76699025-76699047 GGGTGGGGGTGGGGTGGGGAAGG - Intronic
1055986002 9:82056861-82056883 ATGTGTAGGTGGGGGGTGGGGGG - Intergenic
1056101069 9:83301178-83301200 GTGAGTGGGTGTGGTCTGGAAGG - Intronic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056193394 9:84206398-84206420 TTGTGTGTGTGGGGGGTGGTTGG + Intergenic
1056437159 9:86585908-86585930 GTGAGAGGGTGGGGTGGGGAGGG - Intergenic
1056558954 9:87713120-87713142 GTGTGTGTGTGAGGTGTGTAGGG + Intergenic
1056577868 9:87869670-87869692 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1056810184 9:89757916-89757938 GTGGGTGGCTGGGGTGGGGAGGG - Intergenic
1056859361 9:90165496-90165518 GTGTGTGTGTGTGGTGTGGTAGG + Intergenic
1056910293 9:90693990-90694012 GTGTATGGGTGGTGTGTGGGGGG + Intergenic
1057022536 9:91710852-91710874 ATGTGTGGGTGGTGTGTGTAGGG + Intronic
1057036079 9:91812555-91812577 GTGTGTGGGGGGGGTGGGGCGGG - Intronic
1057117717 9:92541414-92541436 GGGTGTGGGCGGGGTGGGGAGGG - Intronic
1057172562 9:92971948-92971970 GTGTGGGGGAGGGGGGTGGATGG - Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057829664 9:98396785-98396807 CTGTGTGGCCGGGGTGCGGTGGG - Intronic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058705678 9:107636499-107636521 GGGTGGGGGTGGGTTGTGGAAGG - Intergenic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059156507 9:111993840-111993862 CGGAGTGGGTTGGGTGGGGAGGG + Intergenic
1059242215 9:112816255-112816277 CTGTGCGGGTGGTGTGGGGATGG + Intronic
1059248092 9:112865239-112865261 ATGTGTGTGTGGTGTGTGTATGG - Intronic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1059705459 9:116819213-116819235 CTGTGTGTTTGGGGTGGGGTGGG - Intronic
1059935176 9:119303269-119303291 CTGTGTGTGTGTGGTGGGGGTGG - Intronic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060503579 9:124181174-124181196 CTCTGTGGGTGGCGTGGGGGCGG - Intergenic
1060557409 9:124515521-124515543 CTCTGGGGGTGGGGTGGGGTGGG + Intergenic
1060661984 9:125409648-125409670 CTGTGTGTGTGGTGTGTGTCTGG - Intergenic
1060815216 9:126631562-126631584 GTGGGTGGGTGGGGTGAGGTGGG + Intronic
1060885697 9:127150495-127150517 CTGTGTGGGTGGGGTGAGGGGGG - Intronic
1060945269 9:127566755-127566777 CTCCTTGGGTGGGGTGAGGAGGG + Intronic
1061061840 9:128254393-128254415 CAGCGTGTGTGGGGTGGGGAGGG + Intronic
1061191384 9:129084789-129084811 CACTGGGGGTGGGGTGGGGAGGG - Intronic
1061211861 9:129198310-129198332 CTGTGTTTGCGGGGTGGGGATGG + Intergenic
1061248191 9:129412154-129412176 GGGTGGGGGTGGGGTGGGGATGG + Intergenic
1061290464 9:129647872-129647894 GTGTGTGTGTGGTGTGTGGGTGG - Intergenic
1061396210 9:130344861-130344883 TTGTGTGTGTGGTGTGTGTATGG + Intronic
1061396221 9:130345017-130345039 GTGTGTGTGTGGTGTGTGCATGG + Intronic
1061943173 9:133893825-133893847 CTGTGTGGGTCAGGTGCGGTGGG - Intronic
1062031046 9:134362133-134362155 CTGTGCGGGTTGGGAGGGGATGG + Intronic
1062038625 9:134393881-134393903 CTGTATGAGTGGGCTGTGCAAGG + Intronic
1062107028 9:134761238-134761260 GTGTGTGGGTGGAGTGTGTGGGG - Intronic
1062210351 9:135360270-135360292 CTGAGGCCGTGGGGTGTGGATGG - Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1203746006 Un_GL000218v1:41065-41087 CGGGGTGGGTAGGGTGTGGGTGG - Intergenic
1203564108 Un_KI270744v1:78417-78439 CGGGGTGGGTAGGGTGTGGGTGG + Intergenic
1185447701 X:268172-268194 CAGTGTGGGTGGGGCCTGCAGGG + Intergenic
1185455470 X:308157-308179 CTGGGTGGGTGGGTGGTGGTTGG - Intronic
1185650277 X:1642507-1642529 CTGTGTGTGTGTGATGGGGACGG + Intronic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185883828 X:3764139-3764161 ATGTATGGGTGGTGGGTGGATGG - Intergenic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186857458 X:13639891-13639913 CTGTGTGGCAGAGGAGTGGAGGG - Intergenic
1186873739 X:13797232-13797254 CCTTGTGGGTGGGGTGAGGGGGG + Intronic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1187879484 X:23833255-23833277 GTGTGTGTGTGTGGTATGGATGG - Intergenic
1188350327 X:29122458-29122480 GTGTGTGGGTGGGGTGGGGGTGG - Intronic
1189074926 X:37905433-37905455 GTGTGTGGGGGGGGCGTGGGGGG + Intronic
1189212175 X:39292656-39292678 CTGGGAGGGTGGTGTGTGGGTGG - Intergenic
1189665404 X:43349961-43349983 CTCTGTGTGTGGGGTGGGGGTGG + Intergenic
1189706491 X:43764010-43764032 CTTTATGGGTTGAGTGTGGAAGG + Intergenic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190330640 X:49233195-49233217 CTCTGGGGGTGGGGTCTGGGTGG + Intronic
1190332042 X:49242152-49242174 CTGGGTGTCTGGGGTGTGGGCGG + Intronic
1190336396 X:49265343-49265365 CTCTGTGGGAGGGGTGTTGCAGG - Intergenic
1190639311 X:52467298-52467320 CTTTGTGGGTGGTGAATGGAGGG - Intergenic
1190886047 X:54531513-54531535 CTGCATGGGTGGTGTGTGGAGGG - Intronic
1190888867 X:54551962-54551984 CTGACTGGGTGAGGTGAGGAGGG + Exonic
1191734347 X:64373646-64373668 GTGTGTGGTTGGGGAGAGGAAGG + Intronic
1192529014 X:71870558-71870580 CTCTGTCCGTGGGGTGTGGAAGG + Intergenic
1192541887 X:71980548-71980570 GTGTGTGTGTGGGGTGTGTGGGG + Intergenic
1192605776 X:72515582-72515604 GTGTGTGGGGGGGGGGTGGGGGG + Intronic
1192638525 X:72843130-72843152 CTGCGTGTGTGGGGTGGGGTGGG + Intronic
1192643189 X:72877678-72877700 CTGCGTGTGTGGGGTGGGGTGGG - Intronic
1192672932 X:73165726-73165748 CTGTGTCAGTGGGCTGTGAAAGG - Intergenic
1192842590 X:74872436-74872458 GTGTGTGGGTGGGGGGTGGTGGG + Intronic
1194988688 X:100520775-100520797 TTGTGTGTGTGTGTTGTGGAGGG + Intergenic
1195174891 X:102305813-102305835 CTGAGGGGGTGGGGTGGGGTGGG + Intergenic
1195183974 X:102381280-102381302 CTGAGGGGGTGGGGTGGGGTGGG - Intronic
1195227753 X:102815679-102815701 CTGTGTGCGTGGGGTGTGTGGGG + Intergenic
1195273732 X:103257816-103257838 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1195314155 X:103661454-103661476 ACCTGAGGGTGGGGTGTGGAAGG + Intergenic
1196195751 X:112837530-112837552 TTGTGTGTGTTGTGTGTGGAAGG + Intronic
1196761572 X:119205449-119205471 GTGTGTGGGTGAGGGGAGGAGGG + Intergenic
1197274497 X:124462426-124462448 GTGTGTGGGGGGGGTGGGGGTGG + Intronic
1197335086 X:125203366-125203388 CTGGGTGCTTGGGGTGAGGATGG - Intergenic
1197644788 X:129005722-129005744 GTGTGTGGGTGGGGCGGGGGGGG - Intergenic
1197770405 X:130085811-130085833 TTGTGGGGGAGGGGTGTTGAGGG - Intronic
1197785326 X:130192088-130192110 GGGTGGGGGTGGGGTGGGGACGG + Intergenic
1198122870 X:133611208-133611230 GGGTGTGGGTGGGGTGTGGGTGG + Intronic
1198160044 X:133999128-133999150 CTGCTTGGGTGGCCTGTGGAGGG - Intergenic
1198463474 X:136884468-136884490 GCGAGTGGGTGGGGTGGGGATGG + Intergenic
1198472327 X:136959094-136959116 TTGTGTATGTGGGGAGTGGAAGG - Intergenic
1198602071 X:138294891-138294913 TTGTGTGTGTGTGGTGTGGAGGG - Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1199525640 X:148788725-148788747 CTGTGATGGTAGCGTGTGGAGGG + Intronic
1200043922 X:153389718-153389740 GTGTGTGTGTGTGGTGTGCATGG - Intergenic
1200044119 X:153391921-153391943 GTGTGTGTGTGTGGTGTGCATGG - Intergenic
1200071911 X:153533431-153533453 CTGTGTGGCTGGGGTGGGAGTGG + Intronic
1200122548 X:153798002-153798024 GTGTGGGGGTGGGGAGGGGAGGG - Intronic
1200216019 X:154368605-154368627 CAGGGTGGGTGGGGTGAGGCAGG + Intronic
1200292083 X:154884759-154884781 CCGTGGGGGTGGGGTGGGGCGGG - Intronic
1200338921 X:155380496-155380518 CCGTGGGGGTGGGGTGGGGCGGG - Intergenic
1200347548 X:155460196-155460218 CCGTGGGGGTGGGGTGGGGCGGG + Intergenic
1200399918 X:156013412-156013434 GAGAGTGGGAGGGGTGTGGACGG + Intergenic
1200403230 X:156030814-156030836 GTGTGTGGGTGTGGTGTGTGTGG + Intergenic
1200734844 Y:6783021-6783043 CTGGGTGGGTGGGATATGCATGG - Intergenic
1200799089 Y:7369456-7369478 GTGTGTGGGTGGGGGATGAAGGG - Intergenic
1200860761 Y:7989266-7989288 CTGTGTGTGTGTAGTGGGGATGG - Intergenic
1201147124 Y:11071038-11071060 TTGGGTGGGTGGGGGGTGGGGGG + Intergenic
1201159329 Y:11156077-11156099 CGGGGTGGGTAGGGTGTGGGTGG - Intergenic
1201229698 Y:11852401-11852423 GTGTGTGGGTAGGGTGTGTGGGG - Intergenic
1201672013 Y:16533466-16533488 ATCTGTGGGTGGAGTGTAGATGG + Intergenic
1201710142 Y:16982303-16982325 CTGTGTGTGTGTGGTTTGTATGG + Intergenic
1202367933 Y:24179604-24179626 CAGCGTGTGTGGGGTGGGGAGGG - Intergenic
1202502850 Y:25490513-25490535 CAGCGTGTGTGGGGTGGGGAGGG + Intergenic