ID: 995834901

View in Genome Browser
Species Human (GRCh38)
Location 5:116390317-116390339
Sequence CAGGGTTGGTGTGGCCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995834901_995834909 0 Left 995834901 5:116390317-116390339 CCTGCTAGGCCACACCAACCCTG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 995834909 5:116390340-116390362 GGTTCTAGACTGTAAACACTGGG 0: 1
1: 0
2: 1
3: 2
4: 103
995834901_995834910 1 Left 995834901 5:116390317-116390339 CCTGCTAGGCCACACCAACCCTG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 995834910 5:116390341-116390363 GTTCTAGACTGTAAACACTGGGG No data
995834901_995834908 -1 Left 995834901 5:116390317-116390339 CCTGCTAGGCCACACCAACCCTG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 995834908 5:116390339-116390361 GGGTTCTAGACTGTAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995834901 Original CRISPR CAGGGTTGGTGTGGCCTAGC AGG (reversed) Intronic
900380003 1:2379136-2379158 CAGGGTTGGTGAGGCCCCTCCGG - Intronic
902042970 1:13505874-13505896 CAAGGCTGGTGTGGCCTGGGTGG + Intronic
904489647 1:30850454-30850476 CAGGGCTGCAGGGGCCTAGCAGG - Intergenic
905801932 1:40849798-40849820 CAGGGCTGGGGTGGGCAAGCGGG - Intergenic
906688525 1:47777951-47777973 CAGGGTGGGTATGCCCTGGCAGG + Intronic
906823505 1:48954053-48954075 AAGGAAGGGTGTGGCCTAGCAGG - Intronic
907771413 1:57468577-57468599 CAGGGTTGGTATGGCAGAGATGG + Intronic
915247876 1:154568867-154568889 CTGGGTTGGAGTGGAATAGCTGG - Intronic
915322559 1:155063789-155063811 CCGGTTTGGTCTGGCCTGGCAGG - Exonic
916588484 1:166167181-166167203 CCGGGTGGGTGAGGCCGAGCAGG + Intergenic
920674462 1:208029540-208029562 CAGGGCTGGCCTGGCCTGGCTGG + Intronic
921361247 1:214332827-214332849 CAGGGCTGAGGTGGCCTAGATGG + Intronic
922184297 1:223260307-223260329 CGGTGTTGCTCTGGCCTAGCAGG + Intronic
1063604128 10:7508096-7508118 CAGGGAGGCTGTGGCCTGGCTGG + Intergenic
1064173097 10:13051261-13051283 CAGCGCTGGAGTGGCCTTGCTGG - Intronic
1064648313 10:17482640-17482662 CAGGGTTGATGTGGCTGATCTGG - Intergenic
1066656490 10:37702993-37703015 CTGGGATGGTGTGGGCAAGCAGG - Intergenic
1070960523 10:80497261-80497283 CAGGCTTTGTGTGGCTGAGCAGG + Intronic
1073283385 10:102370989-102371011 CAGGGCTGGTGCAGTCTAGCGGG + Intronic
1074374318 10:112926770-112926792 GAGACTTTGTGTGGCCTAGCAGG + Intergenic
1074437404 10:113445823-113445845 CAGGGTTGGTGGTGCCTAAATGG + Intergenic
1076239673 10:128894915-128894937 CAGGGATGCTGTGTCCTGGCAGG - Intergenic
1076343207 10:129764218-129764240 CAGGCCTGGTGGGGCCTTGCGGG + Intronic
1078697762 11:13651646-13651668 CTGGGATGGTGGGGCCTGGCTGG + Intergenic
1079100216 11:17536654-17536676 CAGGGTTTGAGTGACCTAACCGG - Intronic
1081663814 11:44904697-44904719 GAGGGGTGGAGTGGCCCAGCAGG + Intronic
1083025712 11:59549149-59549171 CAGGGTTGGTGGGGACGAGCAGG + Intergenic
1083175395 11:60946680-60946702 CAGGGATGCTGTAGCCCAGCAGG + Exonic
1084312900 11:68326989-68327011 CAGGGATGGTGGGGCCAGGCTGG + Intronic
1092992624 12:13917564-13917586 CAGGGTAAATGTGGACTAGCTGG + Intronic
1096385519 12:51192442-51192464 CACGGTTGGTGTGGGCTGGATGG + Exonic
1096627500 12:52904542-52904564 CAGGGCGGGTGAGGCCCAGCAGG + Intronic
1098132845 12:67368435-67368457 CAGGGTGGGTGAGGCACAGCTGG - Intergenic
1103328725 12:120138945-120138967 GAGAGTTAGGGTGGCCTAGCTGG - Intronic
1103721641 12:122978566-122978588 CGGGGTGGGTGAGGCCTGGCCGG + Exonic
1104001443 12:124863330-124863352 CAGGGTTGGGGAGGCCTGGACGG - Intronic
1104748142 12:131222767-131222789 CAGGGGTGGTGTGGCTGAGTCGG - Intergenic
1104903466 12:132201519-132201541 CCGGGTGGGTGTGGACGAGCCGG - Intronic
1108280479 13:48856354-48856376 CAGATTTGGTGTGACCTAGAGGG - Intergenic
1114603261 14:23973288-23973310 CTGGGTGGGTGTGGCCTTGGCGG - Intronic
1115812449 14:37124718-37124740 CAGTGTTGGTGGGGCCTGGTGGG + Intronic
1118331397 14:64818506-64818528 CAGGGTAGATGTGGCCCAGAAGG - Intronic
1118480053 14:66155488-66155510 CAGTGCTGCTGTGGCCTTGCTGG + Intergenic
1120545070 14:85801064-85801086 CAGGGGTGGTGTTGCCAAGGAGG - Intergenic
1121853658 14:97246664-97246686 CAGGGTGGGCATGGCATAGCAGG + Intergenic
1122158154 14:99763544-99763566 GAGGGCTGGTGGGGCCTGGCTGG - Intronic
1122842164 14:104471281-104471303 CAGGCCAGGTGTGGCCTTGCTGG - Intergenic
1122967273 14:105137238-105137260 CAGGGCTGTTGTGGCCTCGGGGG + Intergenic
1124445173 15:29724063-29724085 CAGGTTTGGTGTGGCTCTGCAGG + Intronic
1124629695 15:31329257-31329279 CAGGGTGGGTGTGGCCCTGGGGG + Intronic
1126049583 15:44673973-44673995 CAGAGGTGGTGTGCCCAAGCAGG - Intronic
1128548108 15:68580627-68580649 CAGGGCTGTTGTGGCCCACCTGG + Intronic
1129264977 15:74388577-74388599 CAGGGCTGGTGGGACCTAGCAGG + Intergenic
1130562323 15:84968301-84968323 CTGGTTTGGTGTGGCTTAGCTGG + Intergenic
1131829961 15:96347826-96347848 TGGGGATGGTGGGGCCTAGCCGG - Intergenic
1136554902 16:31001830-31001852 CAGGGTGGATGTGGCCTTGGGGG + Intronic
1137447215 16:48539289-48539311 CAGGGGTGGTGGGCCCTAACTGG - Exonic
1137614257 16:49837547-49837569 CTGGGTTGGGGTGGCATTGCAGG - Intronic
1138053131 16:53803623-53803645 CAGGGATGGTGTGGTGTAGTGGG + Intronic
1141163395 16:81644333-81644355 CATGGATTGTGTGGGCTAGCAGG + Intronic
1143777048 17:9206427-9206449 CAGGGGTGGGGTGGCCGGGCTGG - Intronic
1144777022 17:17789970-17789992 CAGGGAAGAAGTGGCCTAGCAGG - Intronic
1145902472 17:28497687-28497709 CAGGCTTGGAGTGGCCTGGGAGG + Exonic
1146953126 17:36920432-36920454 CAGGGTTGGGGAGGACTGGCGGG - Intergenic
1148783976 17:50136219-50136241 CTGGGTTGGTGGGGGCCAGCAGG + Intronic
1152199321 17:78935917-78935939 CAGGGTTGGGGTGGTCTGGGGGG + Intergenic
1161562907 19:4983617-4983639 CAGGGCTGGTGGGGCTTAGGAGG + Intronic
1163829179 19:19539742-19539764 CAGGGCTGGTGAGGGCTGGCCGG - Exonic
1165698677 19:37920805-37920827 CAGGGCTGCTGGGGCCTGGCCGG - Intronic
1167361708 19:49033723-49033745 CACGATTGGTGTGGCCCAGGGGG + Intronic
1167365640 19:49053726-49053748 CATGATTGGTGTGGCCCAGGGGG - Intergenic
925690202 2:6514611-6514633 CAGTGTTGGTGGGGCCTGGTGGG - Intergenic
925756854 2:7141472-7141494 CAGGGTTGATTTGGCCAATCTGG - Intergenic
929906424 2:46050096-46050118 CAGGGGTAGGGTGGCTTAGCTGG + Intronic
934709124 2:96503684-96503706 CAGGGTCGGGGTGGCCTGACGGG + Intronic
936027408 2:109043956-109043978 CAGGGATGGTGAGGCCAGGCTGG + Intergenic
938390481 2:130901325-130901347 CTGGGCTGGTGTGGCCTCCCTGG + Intronic
944676099 2:202034854-202034876 CTTGGTTCGTGTGGCCCAGCAGG - Exonic
948062805 2:235053938-235053960 CATGATGGGTGTAGCCTAGCTGG - Exonic
948753140 2:240143973-240143995 CAGGCTTGGTGTTCCCGAGCTGG - Intronic
1169134753 20:3190607-3190629 CAGAGTTGGTGTGGCCTACCTGG - Exonic
1169195531 20:3680446-3680468 AGGAGTTGGGGTGGCCTAGCAGG - Intronic
1172629933 20:36371317-36371339 CAGGAAGGGTGTGGACTAGCAGG - Intronic
1173250430 20:41361564-41361586 CAAGGCTGGTGTGGCCAAGGTGG - Exonic
1176587554 21:8603526-8603548 AAGGGTTGGTGCCACCTAGCAGG - Intergenic
1178323681 21:31625803-31625825 CAGGGTTGATGTGGATTACCTGG - Intergenic
1178615539 21:34129809-34129831 CAGGGCTGCTGTGGCCTTGGAGG + Intronic
1179200613 21:39216456-39216478 CAGGGATGGTCAGGCCTGGCTGG - Intronic
1180056358 21:45361170-45361192 CTGGGGTGCTGTGGCCTCGCAGG + Intergenic
1180270384 22:10580524-10580546 AAGGGTTGGTGCCACCTAGCAGG - Intergenic
1181147578 22:20859360-20859382 CAGGGCTGGTGTGGACTCGCCGG + Intronic
1181776018 22:25160728-25160750 CAATGTAGGTGTGGCCTGGCTGG - Intronic
1183676691 22:39302816-39302838 CAGGCTTGGTGAGGCCTGTCTGG - Intergenic
949139800 3:618225-618247 AAGGGTTGGTGCCACCTAGCAGG + Intergenic
952266090 3:31787659-31787681 CAGGGTTGGTGTGGCTGAACCGG - Intronic
953831522 3:46301621-46301643 CAGGTCTTGTGGGGCCTAGCAGG - Intergenic
954473979 3:50725831-50725853 CAGGGTTGGAGTAGCCTCCCGGG + Intronic
956412753 3:68995441-68995463 CAGGATGGGTGTAGCCCAGCAGG - Intronic
958691633 3:97476407-97476429 CAGGGTTGGTGTACTTTAGCTGG - Intronic
960857430 3:122117552-122117574 CAGGCTTTGTGAGGTCTAGCTGG + Intronic
961452659 3:127009359-127009381 CAGGGTTGGGGAGGCAGAGCAGG + Intronic
961469205 3:127100875-127100897 CGGGGTTGGTGTGACCTGGCAGG + Intergenic
961638587 3:128350310-128350332 CAGGCTTGGTGGGCCCTAGCGGG + Intronic
961845740 3:129761389-129761411 CAGGGTTGACATGGCTTAGCAGG - Intronic
962446257 3:135468544-135468566 GAAGGATGGTGTGGCCTAGTGGG + Intergenic
963064455 3:141252618-141252640 CAGTGTAGGTGGGGCCTAGTGGG - Intronic
966203022 3:177377227-177377249 CAGAGGTGGTGTGGCCGTGCCGG + Intergenic
966880476 3:184347099-184347121 CAAGGTTGGTGTGGAATAGGAGG + Intronic
968292891 3:197552685-197552707 CAGGGTTGGGGTGGGATAGATGG - Intronic
968442375 4:630364-630386 CAGGGTGGCTGTGGCCCGGCTGG + Intronic
969516207 4:7649489-7649511 CGGAGATGGTGTGGCCCAGCTGG + Intronic
972077654 4:35106573-35106595 CAGGCTTGGTTTGGCCTCCCAGG - Intergenic
972240763 4:37189227-37189249 CAGGGATGGGGAGGACTAGCCGG + Intergenic
976328327 4:83798523-83798545 TAGGGTTGCTCTGACCTAGCTGG - Intergenic
981044521 4:140253043-140253065 CGGGGCTGCTGCGGCCTAGCCGG - Intergenic
981594365 4:146402538-146402560 CAGGGTTGGAGTGGCCTGTGGGG - Intronic
982523255 4:156446745-156446767 CAGGACTGGTATGGCCTAGATGG + Intergenic
985520543 5:372179-372201 CAGGGCTGGGGTGGGCTGGCGGG + Intronic
986300003 5:6470947-6470969 CAGGGTTGGAGAGGCCTGGGAGG - Intronic
990284564 5:54287860-54287882 CAACCATGGTGTGGCCTAGCAGG + Intronic
995834901 5:116390317-116390339 CAGGGTTGGTGTGGCCTAGCAGG - Intronic
997474457 5:134134505-134134527 CAGGGCTGATGTTGCCTGGCTGG + Intronic
1002050615 5:176568611-176568633 CAGTGCTGGTCTGGCCAAGCTGG - Intronic
1003125425 6:3351933-3351955 CCTGTTTGGTGTGGCCTAGATGG - Intronic
1003264161 6:4550965-4550987 CAGAGTTGGTGCAGCCAAGCTGG - Intergenic
1003264351 6:4552376-4552398 CAGAGTTGGTGCAGCCAAGCTGG - Intergenic
1005222940 6:23608673-23608695 CAGGGTTGTTGTGGTCTAAACGG + Intergenic
1006485321 6:34335278-34335300 CGGGGTCAGTGTGGCCTATCAGG + Intronic
1007738722 6:43998197-43998219 CAGGGCCGGTGGGGCCTGGCGGG - Intergenic
1010555210 6:77270896-77270918 GAGGGTTGGTGTGCCTTAGACGG - Intergenic
1013459466 6:110361049-110361071 CAGGGTTGGTTTTGCCTCCCAGG + Intergenic
1015737401 6:136415489-136415511 CAGGGTTGGTGTGGGTTGTCAGG - Intronic
1018948791 6:168365103-168365125 CAGGGTTTGTGTCGCCTGGGTGG + Intergenic
1024530008 7:50383755-50383777 CAGGGTGGGTGAGGAGTAGCTGG - Intronic
1026669407 7:72375170-72375192 AAGTCTTGGTGTGGCCCAGCTGG + Intronic
1027649242 7:80845062-80845084 CAGGGTTGGGGAGGCCCTGCTGG - Intronic
1028477216 7:91265288-91265310 CCTGGTTCGTGTGGCCCAGCAGG - Exonic
1029117721 7:98245888-98245910 CATGGTTGGAGTTGCCGAGCGGG - Intronic
1032244031 7:130192254-130192276 GAAGGTTGGTGTGGCAGAGCAGG - Intronic
1033291205 7:140084320-140084342 CAGGGGTGTGGTGGCCTGGCTGG - Intergenic
1037963037 8:23114044-23114066 CAAGGTTGGTGGGGCCTCTCGGG + Intronic
1039828823 8:41196614-41196636 CTGGGTTAGTGTGGCTTAGAAGG - Intergenic
1041484602 8:58360600-58360622 CAGGGTTGGGGTGGGGTGGCGGG + Intergenic
1048055238 8:130856502-130856524 GAGTGTTGGTGGGGCCTGGCAGG - Intronic
1048953446 8:139514733-139514755 TAGAGATGGTGTGGCCTGGCAGG - Intergenic
1049338025 8:142096814-142096836 CAGGGTTGGTGGGATCTGGCTGG - Intergenic
1049686629 8:143941738-143941760 GAGGGTGGGTGTAGCCTGGCTGG - Intronic
1052149023 9:25089082-25089104 CAGGGTTGATTTGGCTTATCTGG - Intergenic
1055359625 9:75475831-75475853 GAGGGTTAGTTTGGGCTAGCCGG - Intergenic
1062149471 9:135010131-135010153 CAGGGCAGGTGAGCCCTAGCTGG + Intergenic
1203617519 Un_KI270749v1:81704-81726 AAGGGTTGGTGCCACCTAGCAGG - Intergenic
1189310369 X:40013846-40013868 TAGGGTGGGGGTGGCCGAGCTGG + Intergenic
1191690355 X:63932840-63932862 CAGGGGTTGTCTGGCCTGGCTGG + Intergenic
1199699681 X:150365766-150365788 CGGGGTTCGTGTAGCCTAGGCGG + Intronic
1199985202 X:152945303-152945325 CAGGGTCGGAGAGGCCTGGCAGG + Exonic
1201260964 Y:12158675-12158697 CCGGGTGGGTGTGGCCTTGGTGG - Intergenic