ID: 995834904

View in Genome Browser
Species Human (GRCh38)
Location 5:116390326-116390348
Sequence TCTAGAACCCAGGGTTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995834904_995834909 -9 Left 995834904 5:116390326-116390348 CCACACCAACCCTGGGTTCTAGA 0: 1
1: 0
2: 2
3: 21
4: 186
Right 995834909 5:116390340-116390362 GGTTCTAGACTGTAAACACTGGG 0: 1
1: 0
2: 1
3: 2
4: 103
995834904_995834908 -10 Left 995834904 5:116390326-116390348 CCACACCAACCCTGGGTTCTAGA 0: 1
1: 0
2: 2
3: 21
4: 186
Right 995834908 5:116390339-116390361 GGGTTCTAGACTGTAAACACTGG No data
995834904_995834910 -8 Left 995834904 5:116390326-116390348 CCACACCAACCCTGGGTTCTAGA 0: 1
1: 0
2: 2
3: 21
4: 186
Right 995834910 5:116390341-116390363 GTTCTAGACTGTAAACACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995834904 Original CRISPR TCTAGAACCCAGGGTTGGTG TGG (reversed) Intronic
900590557 1:3457610-3457632 TCTCGGACCCAGTGTTGGTTGGG - Intronic
900881357 1:5383359-5383381 TCCAGATCCCAGGGTGGCTGAGG + Intergenic
902823061 1:18955482-18955504 TCTAGATCCCAGGATGGGGGCGG - Intronic
902999628 1:20255778-20255800 TCTACCACACAGGGTTGTTGTGG + Intergenic
903220940 1:21869415-21869437 TCTAGAAAGCATGGTGGGTGGGG + Intronic
903877105 1:26482381-26482403 TAAAGAACTCAGGCTTGGTGTGG - Intergenic
909985496 1:82156165-82156187 TCAAGAACATTGGGTTGGTGAGG - Intergenic
912226599 1:107741339-107741361 TCTAAATCCCAGGATGGGTGTGG + Intronic
912379628 1:109240390-109240412 GTGGGAACCCAGGGTTGGTGAGG - Intergenic
912865772 1:113254969-113254991 TCTAGTACCCAGAGCAGGTGGGG - Intergenic
915096836 1:153468981-153469003 TCTAAAACCCTGGGTGGGAGCGG + Intergenic
916829046 1:168472515-168472537 GCCAGAAACCAGGGTTGGGGAGG + Intergenic
917249661 1:173044259-173044281 TTTAGAGCCCAAGGTTGGGGGGG - Intronic
917654007 1:177107660-177107682 ACTAGAACCCGGAGCTGGTGAGG - Intronic
922453016 1:225751751-225751773 CCTAGTGCCCAGGGTTGGAGAGG - Intergenic
1063054215 10:2485499-2485521 TTTAAAACCCAGGGTGGGTTAGG - Intergenic
1066183115 10:32982393-32982415 TCTAGAATCCAGGGATGGCCAGG - Intronic
1067191417 10:44071371-44071393 TCTAGGACTTAGGGATGGTGGGG - Intergenic
1067269448 10:44776904-44776926 TCTTGAACCCAGCGGCGGTGGGG - Intergenic
1069992490 10:72323918-72323940 TCCACAGCCCAGGGTTGGGGCGG + Intergenic
1070686877 10:78491454-78491476 GCTAAAACCCAGGGTTTGGGTGG - Intergenic
1071092180 10:81931457-81931479 TCTAGAGCCCAGGGATTGTGTGG - Intronic
1072285241 10:93908266-93908288 TCTATCTCCCAAGGTTGGTGAGG - Intronic
1073453797 10:103624543-103624565 TCTTGAACCCAGGTGTGCTGTGG - Intronic
1074052005 10:109888524-109888546 TGAAGGATCCAGGGTTGGTGTGG - Exonic
1074401437 10:113144148-113144170 GTTAGAAGCCAGGGTTGGGGAGG + Intronic
1074832549 10:117259679-117259701 TCTAGCATCCAGGGTTGCTGTGG + Intronic
1076454897 10:130584412-130584434 TCTAGTACCCAGTGTTGATGAGG - Intergenic
1076621447 10:131791405-131791427 ACTTGAACCCTGGGTTGCTGAGG - Intergenic
1077587194 11:3462735-3462757 GCCAGAACCCAGGGGTGGGGCGG + Intergenic
1081054043 11:38385903-38385925 TCTAGAACCCATTGTTTGAGGGG + Intergenic
1082820795 11:57543483-57543505 TCCAGAGCCCAGGGTGGGGGAGG + Intronic
1083271967 11:61577225-61577247 TCTAAAACCCAGAGGGGGTGAGG - Intronic
1084452929 11:69250791-69250813 TCTGGAACCCATGGCTGCTGCGG + Intergenic
1084453646 11:69254740-69254762 TACAGGACCCAGGGCTGGTGAGG + Intergenic
1087935453 11:104028677-104028699 TCTAGAATGCAGGGTTGTGGTGG - Intronic
1088244692 11:107806071-107806093 TCTAGTAACCAGGTTGGGTGCGG - Intronic
1088469550 11:110178041-110178063 TCTAGAGGCCATGGTGGGTGGGG - Intronic
1089250145 11:117153471-117153493 TCTTGAACCCAGGGTGGCAGGGG - Intronic
1090510638 11:127371119-127371141 TCTAGCAGCCAGGGTTGCTGTGG + Intergenic
1090889906 11:130914688-130914710 TCTGGAACCCAAAGATGGTGAGG - Exonic
1091181266 11:133606559-133606581 TCTACATCCCAGGGTTGAAGTGG - Intergenic
1091484539 12:871891-871913 TGTAGAATCCAGGCTGGGTGAGG - Intronic
1091570295 12:1679257-1679279 TATAAAACCCAGGCTGGGTGCGG - Intergenic
1094379746 12:29830412-29830434 TCTAATACCCAGTGTTGGAGTGG - Intergenic
1095727518 12:45469552-45469574 GCTTGAACCCAGGGTTTTTGTGG - Intergenic
1101212138 12:102545094-102545116 TCTAGAACACAGGGATAGGGAGG + Intergenic
1101436392 12:104668310-104668332 TCTACTACCCAGGGTTGTTCTGG - Intronic
1101469484 12:104983271-104983293 TCTAGAATCCAGGTTTGTTGAGG + Intergenic
1104743528 12:131195830-131195852 TCTGGGACTCAGGGTTGGTCTGG + Intergenic
1104790807 12:131480853-131480875 TCTTGGACTCAGGGTTGGTCTGG - Intergenic
1105272811 13:18893973-18893995 TCTGGAACCCAAAGGTGGTGAGG - Intergenic
1105410388 13:20166998-20167020 TCTTGTACCTAGGGGTGGTGAGG - Intergenic
1107128946 13:36874390-36874412 TCTAGTAGCCAGGGTTAGAGTGG - Intronic
1107738975 13:43428771-43428793 TACAGAAACTAGGGTTGGTGAGG + Intronic
1107848635 13:44547050-44547072 TTTAGTACACAGGCTTGGTGTGG - Intronic
1107872301 13:44758763-44758785 TCTAGAAAGCAGGGTTGCTAGGG + Intergenic
1108619289 13:52165545-52165567 TCTAAAAGGCAGGGTGGGTGTGG + Intergenic
1108640052 13:52374970-52374992 TCTAAAAGGCAGGGTGGGTGTGG + Intergenic
1108999452 13:56779515-56779537 TCAAGGACCCAGGACTGGTGGGG - Intergenic
1109984631 13:69963215-69963237 TTTAGAACCCATGCTAGGTGAGG - Intronic
1111668590 13:91300431-91300453 TCCACAGACCAGGGTTGGTGGGG - Intergenic
1113454714 13:110440076-110440098 TATAGAAACCATGGCTGGTGGGG - Intronic
1113534133 13:111050684-111050706 TCTATAACCCAGGCTGGCTGAGG - Intergenic
1114389065 14:22286359-22286381 TCTAGAAGCCAGGGATGCTCAGG - Intergenic
1116519159 14:45829765-45829787 TCTAGTTTCCAGGGTTGGAGTGG + Intergenic
1117630144 14:57682698-57682720 TATAATACCCAGTGTTGGTGTGG + Intronic
1119785898 14:77313997-77314019 TCTGGAGCCCAGGCTGGGTGCGG - Intronic
1121030001 14:90650031-90650053 GCTAGAACCCAAGGATGTTGTGG + Intronic
1121778891 14:96609069-96609091 TCTACACCTCAGGGGTGGTGGGG - Intergenic
1121799735 14:96764551-96764573 TCACGAACCAGGGGTTGGTGGGG + Intergenic
1128692437 15:69735282-69735304 TCTCCCACCCAGGGTTGGTGTGG + Intergenic
1128839403 15:70837500-70837522 TCTAGAAACCAGGATTTGAGGGG - Intronic
1129060277 15:72855630-72855652 TGTAGAAGCCAGGCTTTGTGGGG + Intergenic
1129782887 15:78285707-78285729 TATAGATCCCAGTGTTGGTCAGG - Intronic
1129966772 15:79743131-79743153 TGAAGAACCAAGGGCTGGTGAGG - Intergenic
1130232961 15:82110513-82110535 TCTAGCACCGAAGGTTGGGGAGG + Intergenic
1131902266 15:97100601-97100623 TCTTGAACCCGGGGATGGTCTGG + Intergenic
1133486178 16:6221250-6221272 TATAAAACCCAAGGCTGGTGAGG - Intronic
1140567434 16:76060540-76060562 TCTAGGACCAAGGGTGGGAGTGG + Intergenic
1140723304 16:77789607-77789629 CCTTGCACCCAGGCTTGGTGAGG + Intronic
1142245141 16:88966888-88966910 TCCAGAGTCCAGGGTGGGTGTGG - Intronic
1142360371 16:89623360-89623382 TCTCGACCCCAGGCTTTGTGTGG - Intronic
1142808798 17:2385759-2385781 TATAGGTCCCAGGGTTGGTCTGG + Exonic
1148882312 17:50738885-50738907 TTTAGAACACGGGGGTGGTGGGG + Intronic
1149402698 17:56314417-56314439 GCTAAAACCAAGAGTTGGTGAGG - Intronic
1150662013 17:67090230-67090252 TCTAGAATGCAAGGCTGGTGTGG - Intronic
1151125949 17:71845012-71845034 TTTTGAACCCAGGATTGCTGAGG + Intergenic
1154464591 18:14631549-14631571 TCTGGAACCCAAAGGTGGTGAGG - Intergenic
1156308742 18:35903984-35904006 TCTAGGACACAGGGTTGGTGTGG + Intergenic
1157815692 18:50728201-50728223 CCTAGAACCCTGGGGTTGTGGGG - Intronic
1161106845 19:2447993-2448015 TCTAGGACCCAGCGGTGGTCAGG - Intronic
1162989597 19:14293680-14293702 TTTAGCACCCAGGGTCTGTGGGG - Intergenic
1164136080 19:22417620-22417642 TCCAGAACCCTCAGTTGGTGGGG + Intronic
1165873749 19:38991356-38991378 TCTGAAGCCCAGGGCTGGTGAGG - Intronic
1168701641 19:58443426-58443448 TCAAGATCCCAGGGAAGGTGTGG - Intergenic
925682888 2:6441573-6441595 TATAGTACCCAGAGTTGATGGGG + Intergenic
926247747 2:11133343-11133365 TCTGGAGCCCAGGGGTGGGGTGG - Exonic
926319066 2:11735657-11735679 CCTAGAACCTGGGGTTGGTGAGG - Intronic
931261601 2:60624712-60624734 TCCAGAGCCCATGGTGGGTGTGG + Intergenic
931684640 2:64783238-64783260 TCTGGAACACAGGGCTGGAGTGG - Intergenic
932664283 2:73684378-73684400 GCTAGAAACCAGGTTTGGGGAGG - Intergenic
933309858 2:80647172-80647194 TCTTGAGCTCAGGGTTGGTGAGG - Intronic
933714338 2:85349335-85349357 TCTGGGTCCCTGGGTTGGTGTGG - Intronic
933742360 2:85544545-85544567 TCTAGAACTAGGAGTTGGTGAGG - Exonic
934765358 2:96877380-96877402 TCCAGTGCCCAGGGTGGGTGCGG - Intronic
936658345 2:114514254-114514276 TGTACATCACAGGGTTGGTGGGG - Intronic
937583311 2:123515269-123515291 TCTAGAACAAAGTGTAGGTGAGG + Intergenic
937943838 2:127312877-127312899 ACTTGAACCCAGGGTGGGGGCGG + Intronic
938711365 2:133978604-133978626 ACTTGAACCCCGGGTTGGTGAGG - Intergenic
942736075 2:179114785-179114807 TCTGGACACCAGGCTTGGTGAGG + Intronic
944373424 2:199012031-199012053 TCTGGAGCCCAGGGTTGCTAAGG + Intergenic
948193665 2:236079083-236079105 TCTAGATGCCAGGCCTGGTGTGG - Intronic
948638075 2:239353094-239353116 GCTCGAACCCAGGGTTGCAGGGG - Intronic
1168846322 20:947056-947078 TCCACAGCCCAGGGTTGGGGTGG + Intergenic
1169029240 20:2395216-2395238 TCTGGAACACAGCTTTGGTGTGG - Exonic
1169134754 20:3190616-3190638 TCTTGGACTCAGAGTTGGTGTGG - Exonic
1171364203 20:24612764-24612786 TCAAGAACTCAGGGTCGGAGAGG + Intronic
1171464667 20:25319201-25319223 GGGAGAACCCAGGGTGGGTGCGG - Intronic
1171780090 20:29410330-29410352 TTTAGGACCCGGGGTTGGGGCGG - Intergenic
1172944576 20:38677367-38677389 TCTAGAACCCTGGAGTGCTGAGG + Intergenic
1172973612 20:38890812-38890834 ACCAGAACCCTGGGCTGGTGAGG + Intronic
1173170603 20:40720546-40720568 TCCAGAATCCAGGGGTGGTCGGG + Intergenic
1175079135 20:56403649-56403671 TCATGAACCCGGGGTTGGTGGGG - Exonic
1175802385 20:61808198-61808220 TTTTGAACCCAGGGCTGGGGTGG - Intronic
1176809948 21:13526835-13526857 TCTGGAACCCAAAGGTGGTGAGG + Intergenic
1181084476 22:20433106-20433128 TCTAAAACCCTGGGTGGATGGGG + Intronic
1183037134 22:35148925-35148947 TCTAGAGTCCTGGGTTGGAGGGG + Intergenic
1183037377 22:35150537-35150559 TCTAGAGTCCTGGGTTGGAGGGG - Intergenic
950425021 3:12920560-12920582 TCTGCAACCCTGGGGTGGTGCGG - Exonic
950811246 3:15651710-15651732 TCTAGAAGTCAGTGTTGGGGAGG + Intergenic
951619003 3:24580206-24580228 TCTGAAATCAAGGGTTGGTGGGG - Intergenic
953383026 3:42488461-42488483 TAGAGAAGCCAGAGTTGGTGTGG - Intergenic
954673767 3:52304533-52304555 TCTAGGATCCAGGGTGGGAGGGG + Intergenic
955942166 3:64156999-64157021 TCTAGAAACCAGGGATGGGTGGG + Intronic
957058535 3:75462687-75462709 GCCAGAACCCAGGGGTGGGGCGG + Intergenic
961294911 3:125877015-125877037 GCCAGAACCCAGGGGTGGGGCGG - Intergenic
966349479 3:179015758-179015780 TCTAGAAAACAGGGTTAGAGAGG + Intergenic
966621717 3:181971723-181971745 CCCAGAACCCAGGTTTGGTGGGG + Intergenic
967363875 3:188663745-188663767 CCACGAACCCAGGGTTGGTGGGG + Intronic
968431866 4:563802-563824 TATGGAACCCTGAGTTGGTGTGG + Intergenic
968432053 4:564807-564829 TATGGAACCCTGAGTTGGTGTGG + Intergenic
968767671 4:2482282-2482304 TTCAGAACCCAGGGTTGGCTGGG - Intronic
968859038 4:3151704-3151726 TCCACAAACCAGGGTTGGCGGGG - Intronic
969229187 4:5817824-5817846 TCTAGCCCCCAGGGTTGGTCTGG - Intronic
975404753 4:73976623-73976645 TCTTGAAGCCAGGGTAGGGGAGG - Intergenic
980909143 4:138978144-138978166 CCTAGAACCCTGGATGGGTGGGG - Intergenic
985040630 4:185888308-185888330 CCTAGAAACGAGGGGTGGTGGGG + Intronic
985747098 5:1653842-1653864 CCTAGTACCCAGAGCTGGTGGGG - Intergenic
985869431 5:2542559-2542581 TTCAGAACCCAGGGTGGGTATGG - Intergenic
985933531 5:3077979-3078001 TCAAGACGTCAGGGTTGGTGAGG + Intergenic
986792460 5:11175871-11175893 GCTGGCACCCAGGGTTGCTGAGG - Intronic
990877289 5:60500016-60500038 ACTAAAACCCAGGCTGGGTGTGG + Intronic
993299969 5:86196250-86196272 TCAAGAGCCCAGGGGTGGTGGGG + Intergenic
995834904 5:116390326-116390348 TCTAGAACCCAGGGTTGGTGTGG - Intronic
1003193166 6:3891859-3891881 TCCAGAACCCAGAGTTGATGTGG + Intergenic
1006374740 6:33665623-33665645 TTTGGAATCCAGGGTGGGTGGGG + Intronic
1006516356 6:34547829-34547851 GCTAGGACCGAGGCTTGGTGGGG - Intronic
1006735878 6:36272041-36272063 TCCACACACCAGGGTTGGTGGGG + Intronic
1007208735 6:40173924-40173946 TCTACATCCTAGGGATGGTGGGG + Intergenic
1013298488 6:108781152-108781174 ACTAGACCCCGGGGTAGGTGGGG - Intergenic
1013394625 6:109722854-109722876 TTTACAACACAGAGTTGGTGGGG + Intronic
1014498249 6:122154923-122154945 TCTGGGAGCCAGGGTTGGGGGGG - Intergenic
1015638685 6:135306687-135306709 ACTAGTGCCCAGGATTGGTGGGG - Intronic
1016179057 6:141121129-141121151 TTGAGAAACCAGGGTTGGTAGGG + Intergenic
1017253884 6:152311694-152311716 TCTAGAACACACAGTTAGTGGGG + Intronic
1017636101 6:156444530-156444552 GCTAGAACCAAGGGTTCTTGTGG - Intergenic
1017636138 6:156444760-156444782 GCTAGAACCAAGGGTTTGTATGG - Intergenic
1017636157 6:156444876-156444898 GCTAGAACCAAGGGTTTGTATGG - Intergenic
1017671605 6:156774670-156774692 GCTGGAACCCAGGGTGGCTGCGG + Intergenic
1023388074 7:39680284-39680306 GCTTGAACCTGGGGTTGGTGAGG + Intronic
1023608927 7:41955025-41955047 TCTAGTACACAGGGCTGGTAAGG + Intergenic
1023967005 7:44967961-44967983 ACCAGAAGCCAGGGCTGGTGAGG + Intronic
1024062939 7:45712610-45712632 TCTAATACCCAGAGTTGGGGAGG - Intronic
1026741794 7:72983512-72983534 TCTAGACCCTGGGGTTTGTGGGG + Intergenic
1027101941 7:75381565-75381587 TCTAGACCCTGGGGTTTGTGGGG - Intergenic
1034046145 7:147929817-147929839 TCTATGGACCAGGGTTGGTGGGG + Intronic
1034940361 7:155226655-155226677 TCCTGCACCCAGGGCTGGTGGGG - Intergenic
1035195981 7:157220785-157220807 TCTAGGACACAGGGTTACTGAGG + Intronic
1036010538 8:4716992-4717014 TATAGAAGCCTGGGTTGATGAGG + Intronic
1038443413 8:27586897-27586919 TCTAGAACTCAGGGTGGGAAGGG - Intergenic
1040102333 8:43516706-43516728 CCTAGAAACCATGGTGGGTGAGG + Intergenic
1041751217 8:61262913-61262935 ACTAGAACTGAGGGTTGTTGGGG + Intronic
1041809090 8:61887463-61887485 TCTGGAGCCCAGGGCTGCTGGGG + Intergenic
1043396207 8:79840104-79840126 TATATAACCAAGTGTTGGTGAGG + Intergenic
1045358392 8:101410192-101410214 ACTAGCCCCCAGGGTTGGTGGGG - Intergenic
1047452001 8:124973321-124973343 TTTAGGACCCTGGGTTGGTGGGG + Exonic
1047647440 8:126883720-126883742 TCAAGAAGCCAGGCTGGGTGTGG + Intergenic
1049381938 8:142320509-142320531 CCTAGAACCTAGGGGTGGTGTGG - Intronic
1050653082 9:7794065-7794087 TCTATAAAACAGGGTTGCTGAGG + Intergenic
1053011299 9:34635260-34635282 TCTAGAACCCCGGTTTGGTGGGG + Exonic
1056545579 9:87610498-87610520 GCTAGAAGCCAGGGCTGCTGAGG - Intronic
1056883979 9:90421866-90421888 TCTAGGAAACTGGGTTGGTGGGG + Intergenic
1056975114 9:91245813-91245835 TCTAGAACACAGGGGAGGAGAGG - Intronic
1057934381 9:99224351-99224373 TCTAAAACCCAGGGTGGGAAGGG - Intronic
1058506735 9:105674132-105674154 ACTGGAACCCAGGGAAGGTGTGG + Intergenic
1060633621 9:125182222-125182244 TTTAGAACCCAGTGTTTGTGAGG - Intronic
1060936766 9:127520526-127520548 TCTAGGACCAAGGGCGGGTGCGG - Intronic
1186550545 X:10500693-10500715 TCTAGTTCCCAGGTTTGGTTTGG + Intronic
1187035529 X:15535163-15535185 AATAGCACCCAGTGTTGGTGAGG - Intronic
1187606099 X:20884687-20884709 TTTAGAACTCAGGGTTGCTAGGG + Intergenic
1190528976 X:51355812-51355834 TCTAAAACCCAGGTTAGGTGTGG + Intergenic
1190896048 X:54619000-54619022 GCTAAAACCTAGGGTTAGTGAGG + Intergenic
1193195142 X:78622822-78622844 TCTAAAACCCAGGATAGATGTGG + Intergenic
1195564251 X:106323402-106323424 TCTACAGCCCAGGGTTGCTGGGG - Intergenic
1195598402 X:106719301-106719323 ACTTGAACCCAGGGTGGGGGAGG - Intronic
1201241060 Y:11956664-11956686 TCTAAAACCCAGGCTGGGCGCGG - Intergenic
1202250081 Y:22861260-22861282 TCTAGAATCAAGGCTTGGCGTGG + Intergenic
1202403070 Y:24495008-24495030 TCTAGAATCAAGGCTTGGCGTGG + Intergenic
1202467712 Y:25175073-25175095 TCTAGAATCAAGGCTTGGCGTGG - Intergenic