ID: 995834908

View in Genome Browser
Species Human (GRCh38)
Location 5:116390339-116390361
Sequence GGGTTCTAGACTGTAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995834904_995834908 -10 Left 995834904 5:116390326-116390348 CCACACCAACCCTGGGTTCTAGA 0: 1
1: 0
2: 2
3: 21
4: 186
Right 995834908 5:116390339-116390361 GGGTTCTAGACTGTAAACACTGG No data
995834901_995834908 -1 Left 995834901 5:116390317-116390339 CCTGCTAGGCCACACCAACCCTG 0: 1
1: 0
2: 1
3: 7
4: 147
Right 995834908 5:116390339-116390361 GGGTTCTAGACTGTAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995834908 Original CRISPR GGGTTCTAGACTGTAAACAC TGG Intronic
No off target data available for this crispr