ID: 995835950

View in Genome Browser
Species Human (GRCh38)
Location 5:116399752-116399774
Sequence CCTTGGCAGTGTAAAATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995835950_995835957 19 Left 995835950 5:116399752-116399774 CCCTACATTTTACACTGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 126
Right 995835957 5:116399794-116399816 CACAGAGGAAAAGAATGTGATGG 0: 1
1: 0
2: 7
3: 72
4: 630
995835950_995835955 4 Left 995835950 5:116399752-116399774 CCCTACATTTTACACTGCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 126
Right 995835955 5:116399779-116399801 ACTGCCATAGTCTTGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995835950 Original CRISPR CCTTGGCAGTGTAAAATGTA GGG (reversed) Intronic
903951815 1:26999977-26999999 CCTTGCCACTGTAAAGTGAAAGG - Exonic
904397934 1:30235250-30235272 CCTTGTGATTGTAAAATGCATGG + Intergenic
907900928 1:58740938-58740960 CCCAGACAGTGTAAAATGCAAGG + Intergenic
913472998 1:119208770-119208792 ACTTGGAAATGTAGAATGTATGG + Intergenic
916907868 1:169308219-169308241 CATTGTCAGGGTAAAATGGAGGG + Intronic
919552726 1:199012032-199012054 TCTAGGAAGTGAAAAATGTAGGG + Intergenic
920223036 1:204418238-204418260 CCTTGGCCCTGCAAAGTGTAGGG - Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
923270236 1:232348772-232348794 ACTTAGCACTGGAAAATGTATGG + Intergenic
924862017 1:247935472-247935494 CTTTGTAAGTTTAAAATGTATGG + Intergenic
1063473134 10:6305110-6305132 CCTTGGCCTTGCAAAATGTTGGG + Intergenic
1063904342 10:10766932-10766954 CGTTGGCAGTGAGAAATGAACGG - Intergenic
1064298882 10:14104237-14104259 CCATGGCAGTGTAAACTCGATGG - Intronic
1064586487 10:16844345-16844367 CCATGGAAGTGTGAAATGCATGG + Intronic
1065500056 10:26371888-26371910 TCTTGGGAGTTTAAAATGTAAGG + Intergenic
1067266534 10:44750314-44750336 CCTTGGCAGTGACCAATGAATGG - Intergenic
1067328042 10:45288275-45288297 CCATGACAGTTTACAATGTAGGG + Intergenic
1073712606 10:106061685-106061707 CCTTGGCCCTGCAAAATGTTGGG - Intergenic
1075793175 10:125099961-125099983 ACTTGGCAGTGTCAAATTTAAGG - Intronic
1077571582 11:3343597-3343619 TCTCGGCATTGTAAAATGCAAGG + Intronic
1078136387 11:8655530-8655552 CCTTGGCATTCCAAAATGTTGGG - Intronic
1081513439 11:43800459-43800481 CATTGGCATTGGAAAATGTTGGG + Intronic
1082874917 11:57978224-57978246 CCTAGGCACTGTAAGATGTTTGG - Intergenic
1082963120 11:58938174-58938196 TCTTGGCAGTGTGTAATTTATGG + Intronic
1083979501 11:66155105-66155127 TCTGGGCAGTGTATAAGGTATGG - Intronic
1084394844 11:68902689-68902711 CCTTGGTAGTGTACATTCTATGG + Intronic
1086863922 11:91957263-91957285 GCTTGCCAGAATAAAATGTAAGG + Intergenic
1091551820 12:1541136-1541158 CCTTGGCACTGGAAAATATGGGG + Intronic
1096201108 12:49683805-49683827 CCGTTGAAGTGTAAAGTGTAAGG - Intronic
1096742844 12:53706715-53706737 CCTTGGCCTTGCAAAATGTTGGG + Intergenic
1099100102 12:78428793-78428815 CCTTGGAAGTGTCAAAGGGAGGG - Intergenic
1100020391 12:90062421-90062443 CCTTGGCATTGCAAAGTGTTGGG - Intergenic
1106644573 13:31618224-31618246 ATTTGGAACTGTAAAATGTAAGG + Intergenic
1107132361 13:36910476-36910498 GCTTTTAAGTGTAAAATGTATGG - Intronic
1108143834 13:47455657-47455679 CCTTGGTATTGTAAAATTTGAGG - Intergenic
1111154422 13:84303801-84303823 CCTTGTCAGTGCAAAAGGTCAGG - Intergenic
1113363766 13:109656611-109656633 CCTTTGCAGTTTAAATTGCAGGG - Intergenic
1114633411 14:24173649-24173671 CCTTGGCAGTGAAAACAGTGTGG - Intronic
1114893182 14:26951470-26951492 ACATGGAACTGTAAAATGTATGG + Intergenic
1115817187 14:37176144-37176166 CCTTGGCCTTCTAAAATGTTGGG + Intergenic
1116189976 14:41652290-41652312 TCCTAGAAGTGTAAAATGTAAGG + Intronic
1120903791 14:89601404-89601426 CCTTTGCAGTGTACTATGGATGG - Intronic
1124139993 15:27068677-27068699 CCCTGCCAGTGCAACATGTAAGG - Intronic
1127288064 15:57547673-57547695 CTTTTGCAGTTTAAAATGTTGGG + Exonic
1140167388 16:72566814-72566836 CATTGGAAGTGAAAAATGTGTGG + Intergenic
1140843580 16:78865149-78865171 CTTTAGCACTTTAAAATGTACGG - Intronic
1146862469 17:36316035-36316057 CTTTGGCAGCCTAAAATGTCAGG - Intronic
1147092797 17:38120133-38120155 CTTTGGCAGCCTAAAATGTCAGG - Intergenic
1147104411 17:38200357-38200379 CTTTGGCAGCCTAAAATGTCAGG + Intergenic
1148425080 17:47588070-47588092 CTTTGGCAGCCTAAAATGTCAGG - Intronic
1148514039 17:48199407-48199429 ACCTGGCAGTGTAAAGTGCATGG - Intronic
1150114285 17:62531828-62531850 CCTTGGCAGTGTAAGAGTTGGGG - Intronic
1159644805 18:70905280-70905302 CCTTGGCTGTTTAAATTGTCTGG - Intergenic
1162930910 19:13957241-13957263 CCTTGACAGTGACAAATGTCAGG + Intronic
1164314735 19:24077401-24077423 CCTTGGCTGTGTAAAACAAAAGG - Intronic
925103949 2:1273069-1273091 ACTTGGCAGTGGAAAATCCACGG - Intronic
925381840 2:3433606-3433628 GCTGGGCAGTGAAAAATGAAAGG - Intronic
927181745 2:20451584-20451606 CCTTGTCAGTGTACAGAGTAGGG + Intergenic
928007358 2:27575321-27575343 CCTTCAAAGTGTAAAATTTATGG + Intergenic
928180586 2:29065644-29065666 CCTTGGGAGTGCAGAATGGAGGG + Intronic
932751169 2:74372585-74372607 ACTTGGCCATGTAAAATGTCAGG - Intronic
935934218 2:108164450-108164472 TCTTGGCACTGTAAAATTCATGG + Intergenic
937680421 2:124638397-124638419 CCTTGGCAGAATAAATTCTAAGG - Intronic
940972540 2:159909316-159909338 CATTGGCATTGTAAAATTTTTGG + Intergenic
941465225 2:165817527-165817549 CATAGGCAGTAGAAAATGTATGG + Intergenic
942063494 2:172248939-172248961 CCTGAGCAGTGAAAAATGTCAGG + Intergenic
942357862 2:175138679-175138701 CCTTGACAGTGTAATATCAAAGG - Intronic
943505298 2:188748405-188748427 CCTGAGCAGTGTAATATGTATGG - Intronic
943922750 2:193730206-193730228 CTTTGGCAGTATAAATTGTTGGG - Intergenic
944699238 2:202231375-202231397 CCTTGGCCTTGCAAAATGCAGGG - Intronic
944775022 2:202954757-202954779 CCTTGGCATTCTAAAGTGTTGGG - Intronic
945968102 2:216209762-216209784 CCTGGGCAATGTAAAATGGGAGG - Intergenic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
1170455634 20:16530424-16530446 CCCTGGCAGTGTGAAAAGTCAGG + Intronic
1173480843 20:43398130-43398152 CCTTGGCATGCTAAAATGTTGGG - Intergenic
1175274023 20:57755077-57755099 GCTGGGCAGTATAAAATGTTTGG - Intergenic
1181149903 22:20875702-20875724 CCTTGGCCTTATAAAATGTTGGG - Intronic
949653735 3:6192428-6192450 CCTTGGCTGTGTTCAATCTATGG + Intergenic
950034887 3:9878273-9878295 TCTTGGCAGTGCAAAATCTCGGG + Intronic
955606414 3:60710190-60710212 GCATGGCAGTGAAAAATGAAAGG + Intronic
965271700 3:166624824-166624846 CATTTTCACTGTAAAATGTAAGG + Intergenic
969228675 4:5815150-5815172 CTGTGGCATTGTAAACTGTAAGG + Intronic
969386825 4:6856534-6856556 GCTTGGGAGTTTAAAATTTAAGG - Intronic
971050122 4:22852126-22852148 CTTTGGCAAAGTAAAATGTCTGG + Intergenic
971582517 4:28360924-28360946 GCTTGACACTGCAAAATGTAAGG - Intergenic
975669136 4:76762646-76762668 CTTTGTGAGTGTAAAATGTTAGG + Intronic
975838406 4:78448975-78448997 ATTTTGCAGTGAAAAATGTATGG + Intronic
976444558 4:85115922-85115944 GCTTTTCATTGTAAAATGTAAGG - Intergenic
980062288 4:128144123-128144145 CCATGACAATGAAAAATGTATGG + Intronic
980069598 4:128229415-128229437 CCTTGGCTGTGTGAAATAGACGG + Intergenic
982270746 4:153584562-153584584 ACTTGGCAGAGTAAAATGTGTGG - Intronic
984476926 4:180246573-180246595 CCTGGGCAGTGTATCATGCAGGG + Intergenic
984563794 4:181302814-181302836 CCCTGGAAATGTAAAATGAAGGG + Intergenic
993633473 5:90315887-90315909 CCTTGACAGTGTAAAAACTGAGG - Intergenic
993807527 5:92430184-92430206 GATTGGCACTATAAAATGTAAGG - Intergenic
994770092 5:103971051-103971073 CCCTTGCAGTGAATAATGTAAGG - Intergenic
994831711 5:104792144-104792166 GCTTGGCAGTGTAAAGTGGAGGG + Intergenic
995835950 5:116399752-116399774 CCTTGGCAGTGTAAAATGTAGGG - Intronic
1000153703 5:158529534-158529556 CTTTGGCACTGTGAAAAGTAAGG + Intergenic
1001321537 5:170686542-170686564 CCTTTGCAGTGTAAAGTCTCTGG - Intronic
1002292245 5:178207925-178207947 CCTTGGCCTTGTAAAGTGTTGGG + Intronic
1006530890 6:34652903-34652925 CCTTGGCATTCTAAAATGCTGGG - Intronic
1006630125 6:35424895-35424917 TCTTGGCAGTGGAACATGCAAGG + Intronic
1010217941 6:73421411-73421433 TCTTGGGAGTGGAAAATGAAGGG - Intronic
1011409459 6:87052496-87052518 CATTGGCACTGTTAAATGAAGGG + Intergenic
1012464008 6:99496968-99496990 TCTTGGCAGTGTACATTCTATGG + Intronic
1012906437 6:105071958-105071980 CCTTGGCAGTGTAAAGAATCTGG + Intronic
1015870072 6:137767379-137767401 CCTTTGCAAGGGAAAATGTATGG - Intergenic
1026206832 7:68264946-68264968 CCAGGGCAGTGGAAAATATATGG + Intergenic
1027402698 7:77824780-77824802 CCTTGGCAGCCCAAAATGTTAGG - Intronic
1028880956 7:95879643-95879665 CCTTAACTGTCTAAAATGTATGG - Intronic
1031173754 7:118323081-118323103 CCTTGGCCTTCTAAAATGTTGGG + Intergenic
1032043990 7:128587601-128587623 CCTTGGCAGTGTAAGAGTTGGGG - Intergenic
1032253870 7:130281574-130281596 CCTTGTCAGGGATAAATGTAAGG - Intronic
1032848448 7:135771938-135771960 CCTAAGCAGAGTAAGATGTATGG + Intergenic
1041385872 8:57301420-57301442 TCTTGGCATTGTATAAAGTAGGG + Intergenic
1041533504 8:58898723-58898745 CCTTTGCAATGGAAACTGTAGGG + Intronic
1043666584 8:82822408-82822430 CTTTGGCAGTGTAATGTGCAGGG - Intergenic
1048190933 8:132288169-132288191 CATTCTCAGTGTAAAATATATGG + Intronic
1050734606 9:8748659-8748681 CCTTGGCTGTTCAAAATGTTGGG - Intronic
1051253943 9:15192381-15192403 GCTTTGGATTGTAAAATGTAAGG - Intronic
1055589972 9:77802200-77802222 TCTTGGCAATGAAAAATGCAGGG - Intronic
1056526930 9:87452039-87452061 CCTTGGGATTGTGAAATGGAGGG - Intergenic
1058040950 9:100301295-100301317 CGTAGGAACTGTAAAATGTAAGG - Intergenic
1059867630 9:118534108-118534130 CCTTGGCACAGTTAGATGTAAGG - Intergenic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1186463061 X:9764049-9764071 CCTTGGCATCGTAAAGTGTTAGG - Intronic
1187361797 X:18635038-18635060 CCTTGCCACAGTAAAAAGTATGG - Intronic
1188165805 X:26862097-26862119 TCTTGGGAGTGTACATTGTATGG + Intergenic
1194430089 X:93792520-93792542 CCTTTGAAGAGTAAAGTGTAGGG - Intergenic
1195628502 X:107029451-107029473 CCTTGGCAATGCAAAGTGTTGGG - Intergenic
1199531345 X:148851191-148851213 ACTCGTCAGTGTAAAATGGAGGG - Intronic