ID: 995839480 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:116430127-116430149 |
| Sequence | GGCACACATGGTGGTGAGAC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995839480_995839487 | 24 | Left | 995839480 | 5:116430127-116430149 | CCGGTCTCACCACCATGTGTGCC | No data | ||
| Right | 995839487 | 5:116430174-116430196 | CACTTAACTCCAGGCCTTACTGG | No data | ||||
| 995839480_995839486 | 15 | Left | 995839480 | 5:116430127-116430149 | CCGGTCTCACCACCATGTGTGCC | No data | ||
| Right | 995839486 | 5:116430165-116430187 | CTCAAACTGCACTTAACTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995839480 | Original CRISPR | GGCACACATGGTGGTGAGAC CGG (reversed) | Intergenic | ||