ID: 995840407

View in Genome Browser
Species Human (GRCh38)
Location 5:116438503-116438525
Sequence TTGGGGCAGCAGTCCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995840407_995840418 -4 Left 995840407 5:116438503-116438525 CCAGCCAGGGACTGCTGCCCCAA No data
Right 995840418 5:116438522-116438544 CCAAGGGCAGGAGGAAGGCTGGG No data
995840407_995840413 -9 Left 995840407 5:116438503-116438525 CCAGCCAGGGACTGCTGCCCCAA No data
Right 995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG No data
995840407_995840416 -5 Left 995840407 5:116438503-116438525 CCAGCCAGGGACTGCTGCCCCAA No data
Right 995840416 5:116438521-116438543 CCCAAGGGCAGGAGGAAGGCTGG No data
995840407_995840419 17 Left 995840407 5:116438503-116438525 CCAGCCAGGGACTGCTGCCCCAA No data
Right 995840419 5:116438543-116438565 GGCACCCAAATTCAAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995840407 Original CRISPR TTGGGGCAGCAGTCCCTGGC TGG (reversed) Intergenic
No off target data available for this crispr