ID: 995840413

View in Genome Browser
Species Human (GRCh38)
Location 5:116438517-116438539
Sequence CTGCCCCAAGGGCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995840407_995840413 -9 Left 995840407 5:116438503-116438525 CCAGCCAGGGACTGCTGCCCCAA No data
Right 995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995840413 Original CRISPR CTGCCCCAAGGGCAGGAGGA AGG Intergenic
No off target data available for this crispr