ID: 995840995

View in Genome Browser
Species Human (GRCh38)
Location 5:116443108-116443130
Sequence TTACATATTAATAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995840995_995841000 19 Left 995840995 5:116443108-116443130 CCCTCCACCTTATTAATATGTAA No data
Right 995841000 5:116443150-116443172 GTGCAAGGATCTATTTTTAGTGG No data
995840995_995840999 4 Left 995840995 5:116443108-116443130 CCCTCCACCTTATTAATATGTAA No data
Right 995840999 5:116443135-116443157 ACTGAAGTCACATCTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995840995 Original CRISPR TTACATATTAATAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr