ID: 995841434

View in Genome Browser
Species Human (GRCh38)
Location 5:116446803-116446825
Sequence GAGTCCACCCTCTGCGGGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995841426_995841434 7 Left 995841426 5:116446773-116446795 CCAGATGGCTGGGAGCTGTGCAC 0: 1
1: 0
2: 2
3: 11
4: 249
Right 995841434 5:116446803-116446825 GAGTCCACCCTCTGCGGGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 146
995841421_995841434 29 Left 995841421 5:116446751-116446773 CCTCGAGACAGTCACGGCCTGGC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 995841434 5:116446803-116446825 GAGTCCACCCTCTGCGGGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 146
995841425_995841434 12 Left 995841425 5:116446768-116446790 CCTGGCCAGATGGCTGGGAGCTG 0: 1
1: 0
2: 2
3: 49
4: 508
Right 995841434 5:116446803-116446825 GAGTCCACCCTCTGCGGGGCGGG 0: 1
1: 0
2: 1
3: 11
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995841434 Original CRISPR GAGTCCACCCTCTGCGGGGC GGG Exonic
900126814 1:1072427-1072449 GAGGCCACCCTCTCCGAGCCAGG + Exonic
900297335 1:1958425-1958447 GAGTCCAGCCTGGACGGGGCTGG + Intronic
901386358 1:8912021-8912043 GAGTCCACCATCTGGGAGGCAGG + Intergenic
901512390 1:9723994-9724016 GAGTTCACCCTCTCCTGTGCTGG + Exonic
902533368 1:17104842-17104864 AAGTCCAGCCTCTGCGGGCCCGG - Intronic
902622000 1:17656126-17656148 GAGAGCAGCCTCTGCAGGGCTGG + Intronic
903384004 1:22915078-22915100 GAGCGCACCCTCTGGAGGGCAGG - Intronic
912234575 1:107835493-107835515 CATGCCTCCCTCTGCGGGGCTGG + Intronic
916949946 1:169769588-169769610 GAGTCCACTCTCTGTGGTGGTGG - Intronic
917977327 1:180248555-180248577 GAGTCCACTCTGGGAGGGGCAGG + Intronic
920555370 1:206900374-206900396 GACACCACCCTCTGTGGGACGGG + Intronic
922676678 1:227557455-227557477 GAGTCCACCCTTTCCAGGTCTGG - Intergenic
1062796987 10:352020-352042 GGGGCCTCCCTCAGCGGGGCGGG - Intronic
1064690672 10:17915109-17915131 GAGTCCACAATCTACCGGGCAGG + Intergenic
1065732427 10:28721753-28721775 GAGCCCACCCTCTGTGGCACTGG + Intergenic
1067153243 10:43753487-43753509 GAGTCCCCCCTCTGGGGCCCAGG - Intergenic
1067696308 10:48537910-48537932 CAGTCCACACTCTCAGGGGCCGG - Intronic
1068656479 10:59581287-59581309 GAGTCCACAATATGGGGGGCAGG + Intergenic
1070398720 10:76034420-76034442 GTGTCCCCCCTCGGTGGGGCTGG + Intronic
1074323098 10:112421668-112421690 AAGTCCTCCATCTGCTGGGCAGG + Intronic
1075514223 10:123096457-123096479 CAGCCAACCCTCTGCAGGGCTGG + Intergenic
1075704550 10:124492403-124492425 GAGTCCAAAATCTGCAGGGCAGG + Intronic
1076576650 10:131474134-131474156 GAGTCCACACTGTGCAGGCCGGG + Intergenic
1076904848 10:133356647-133356669 GAGTCCATCCTACGCAGGGCCGG - Exonic
1080026363 11:27619620-27619642 GAGTCCACAATCTGCAGGTCAGG - Intergenic
1081933120 11:46886271-46886293 GAATCCACCCTCTCCAGGGAAGG - Intronic
1084380047 11:68805935-68805957 GAGGCCTCCGTCTGGGGGGCTGG - Intronic
1084490397 11:69475330-69475352 GAGCCCAGCCTCTGTGGGGCAGG - Intergenic
1086654906 11:89342119-89342141 GAGGTCAGCCTCTGCGTGGCTGG - Exonic
1088540785 11:110911502-110911524 GACTCCACACTCTGCAGGGTGGG - Intergenic
1091356389 11:134941027-134941049 GAGGCCACCCTGTGGGGGGGGGG + Intergenic
1096623468 12:52879025-52879047 GAGCCCAGCCTCGGAGGGGCAGG + Intergenic
1096677284 12:53232442-53232464 GACTCCATCCTCTGGGAGGCCGG + Intronic
1103521685 12:121540286-121540308 GCATCCTCCCTGTGCGGGGCCGG + Intronic
1103989768 12:124791024-124791046 GTGGCCACCCTCTGCCTGGCAGG - Intronic
1104928462 12:132325927-132325949 GAGTCCAGCCGCTGCGACGCGGG + Intronic
1104949036 12:132430535-132430557 GAGTCCACACCCTGCGAGTCAGG - Intergenic
1113608288 13:111625759-111625781 AAGTCCACAGTCTGCAGGGCAGG - Intronic
1114063434 14:19039291-19039313 GAGTCCACCCTGTGGGGATCTGG - Intergenic
1114098822 14:19360705-19360727 GAGTCCACCCTGTGGGGATCTGG + Intergenic
1114348568 14:21824158-21824180 AAGTCCAACTTCTGCAGGGCAGG + Intergenic
1121470101 14:94146188-94146210 AAGTCCTCCTTCTGCTGGGCCGG - Intronic
1121831770 14:97058674-97058696 GAGTCCAAAATCTGCAGGGCTGG + Intergenic
1123493117 15:20798887-20798909 GAGTCCACCCTGTGGGGATCTGG + Intergenic
1123549623 15:21367989-21368011 GAGTCCACCCTGTGGGGATCTGG + Intergenic
1124318698 15:28694474-28694496 GACTCCACCTTCTGGGGTGCTGG + Intergenic
1124564747 15:30802966-30802988 GACTCCACCTTCTGGGGTGCTGG - Intergenic
1125713320 15:41804566-41804588 GACTCCACACTCTCCAGGGCAGG - Intronic
1127820953 15:62655618-62655640 CAGTACACCCTCTGTGGAGCAGG - Intronic
1127821192 15:62657670-62657692 CAGTACACCCTCTGTGGAGCAGG - Intronic
1129424000 15:75451720-75451742 GAGTCTTCCCTCTGCGGGGCGGG - Intronic
1130137832 15:81196737-81196759 AGGTCCACCATCTGCTGGGCTGG - Intronic
1131860782 15:96651153-96651175 GAGTGCACCGTCTGAGGGGCAGG + Intergenic
1202957954 15_KI270727v1_random:95207-95229 GAGTCCACCCTGTGGGGATCTGG + Intergenic
1132850498 16:2022921-2022943 GAGTCCTCCTTCGGCGGGGGAGG - Intergenic
1132864336 16:2086123-2086145 ACCCCCACCCTCTGCGGGGCAGG + Intronic
1139469472 16:67170552-67170574 GGGTCAAGCCTCGGCGGGGCAGG - Exonic
1141225000 16:82106547-82106569 GAATCCCCCCTATGCAGGGCAGG + Intergenic
1141730903 16:85822274-85822296 GAGGCCAGGCCCTGCGGGGCAGG + Intergenic
1142131509 16:88433550-88433572 GACTGCACCCTCGGTGGGGCCGG - Exonic
1142471629 17:166294-166316 GCCTCCACCTTCTGTGGGGCTGG + Intronic
1143016516 17:3893469-3893491 GAGTGTAGCTTCTGCGGGGCGGG + Intronic
1146624564 17:34425360-34425382 GAGCCCACCCTCGGCTGAGCTGG - Intergenic
1147162221 17:38574889-38574911 GACTCCGCCCCCTCCGGGGCTGG - Intronic
1147360851 17:39928636-39928658 AAGTCCACTCTATGCAGGGCAGG + Intergenic
1148760501 17:49997280-49997302 GAGGGCACAGTCTGCGGGGCGGG - Intergenic
1149665554 17:58362757-58362779 GAGTCCTCCATCTGAGGGGATGG + Intronic
1152654148 17:81512360-81512382 GAGTCCATCCTTTTCCGGGCAGG - Exonic
1154450660 18:14473424-14473446 GAGTCCACCCTGTGGGGATCTGG + Intergenic
1161067420 19:2245558-2245580 GAGTCTGCCCGCAGCGGGGCCGG + Intronic
1161168377 19:2800785-2800807 CAGTGCACCCACTGAGGGGCAGG - Intronic
1162035019 19:7933993-7934015 GACTCCACCCCCTGCGAGGGAGG + Exonic
1162122276 19:8478522-8478544 GGGTCCGCCCTCTGGGGTGCAGG + Intronic
1163234146 19:16021244-16021266 GTGTCCACCCTCTGAGAGGCTGG - Intergenic
1164033342 19:21431486-21431508 GAGTCCACCCTTTCCAGGTCTGG + Intronic
1164840392 19:31388700-31388722 GAGGCCAACCTCTGGAGGGCAGG - Intergenic
1164853454 19:31502924-31502946 TAGATCACCCTCTGCGGGTCCGG + Intergenic
1164853472 19:31503021-31503043 CAGACCACCCTCTGCAGGTCCGG + Intergenic
1165245528 19:34496511-34496533 CAGTGCACTCTCTGCGGGGCAGG - Intronic
1167246404 19:48375786-48375808 GAGGGCACCCTCTGCAGGGTGGG + Intronic
1168269551 19:55242092-55242114 GAGACCCGCCTCTGAGGGGCCGG + Intronic
925688541 2:6496416-6496438 GAGTTCACCCTCTCCTGTGCTGG - Intergenic
931073164 2:58677892-58677914 GAGTCCAAAGTCTGCAGGGCAGG + Intergenic
931973119 2:67612457-67612479 GAGTCCACAGTCTGCAGGGTGGG - Intergenic
932345641 2:70993765-70993787 GAGTCCAGCCGCTGCAGGGTGGG + Exonic
932605618 2:73163449-73163471 GATTCCACCCTCTGTGGAGGTGG - Intergenic
933796594 2:85924909-85924931 GTGTCTTCCCTCTGCTGGGCGGG - Intergenic
936399169 2:112152770-112152792 AAGTCCAACCTCCGCAGGGCAGG - Intronic
944515909 2:200511434-200511456 GAGTCCACCTTCTGCAGAGATGG + Intronic
945037887 2:205719711-205719733 GAATTCACCTTCTGCGGGGAAGG + Intronic
946069106 2:217015810-217015832 GAGTCCACCGTCTGGGGAGCAGG + Intergenic
946488182 2:220121105-220121127 GAGTCCAGCCTCTGTGGGGAAGG + Intergenic
947751267 2:232533968-232533990 GGGTCCATCCTCTGCTGGGCGGG - Exonic
948976223 2:241465339-241465361 GAGTCCCCCCTCCCCAGGGCAGG + Intronic
1171166532 20:22976771-22976793 GAGCCCACCCTCAGTGGGGAAGG + Intergenic
1172661748 20:36573480-36573502 GCGCCCACCCCCCGCGGGGCGGG - Exonic
1175307082 20:57983348-57983370 GAGTCCACCCCGTGCTGGACAGG + Intergenic
1175569700 20:60009550-60009572 CCCTCCTCCCTCTGCGGGGCAGG + Intronic
1175852299 20:62100118-62100140 GGGACCACCCTCTGCCGGGCGGG - Intergenic
1175994025 20:62804521-62804543 GAGACCGTCCTCTGGGGGGCGGG + Intergenic
1177169044 21:17635514-17635536 GATTCCACCCTCTGGAGGCCAGG - Intergenic
1178489044 21:33036339-33036361 GAGTCCCCCCTCTCAGGGCCAGG + Intergenic
1179130913 21:38636421-38636443 GAGTTCACCCTCTGGGGGAAGGG + Intronic
1179411981 21:41168819-41168841 GAGCTCCCCCTCCGCGGGGCTGG + Intronic
1180481928 22:15761925-15761947 GAGTCCACCCTGTGGGGATCTGG - Intergenic
1183585228 22:38749586-38749608 GAGTCCATCCTCTGTCAGGCAGG + Intronic
1185291740 22:50030876-50030898 GGGTCCGACCTCTGCGTGGCGGG - Exonic
1185397736 22:50601170-50601192 GGGCCGACCCTCTGCGGGGGAGG + Intronic
950410257 3:12831513-12831535 CGGTCCACCCTCTGCAGGACAGG - Exonic
954256611 3:49411836-49411858 GAGTCCAGCCTCTTCGCGCCGGG + Exonic
954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG + Intronic
954775157 3:53010434-53010456 GACTGAACCCTCTGTGGGGCTGG + Intronic
960535891 3:118813807-118813829 AAGTCCACCCTCTGGGGGAAGGG - Intergenic
960992674 3:123322084-123322106 GAGCTCTCCCTCTGGGGGGCAGG + Intronic
968676413 4:1883333-1883355 GTGTACCCCCTCTGCAGGGCTGG + Intronic
968900453 4:3429080-3429102 GAGTCCACCCTAGGCAGAGCTGG + Intronic
971907683 4:32748361-32748383 GAGTCCAGCCCCTGGGCGGCGGG + Intergenic
973840785 4:54858315-54858337 GAGTCCAAAATCTGCAGGGCAGG - Intergenic
979209443 4:118081635-118081657 CAGTTCATCCTCTGGGGGGCAGG - Intronic
984701111 4:182819396-182819418 GAGCCCAGCTTCTGCGGGTCAGG + Intergenic
985964046 5:3326206-3326228 GAGTCCACCCGCGCCGCGGCGGG + Intergenic
986249503 5:6043774-6043796 GAGTCCGCCCTGTGGGTGGCAGG - Intergenic
995841434 5:116446803-116446825 GAGTCCACCCTCTGCGGGGCGGG + Exonic
998119245 5:139562052-139562074 GAGTCCACACCATGCGGGCCTGG - Intronic
1002299192 5:178247929-178247951 GACTCTGCCCTCTGGGGGGCAGG - Intronic
1003683516 6:8278622-8278644 GAGTGCAGCCTCTGCGTGGAAGG - Intergenic
1004202070 6:13558217-13558239 GAGTCCACCATGTCCTGGGCAGG - Intergenic
1006993168 6:38232948-38232970 GAATCCACCCACTGAGGAGCTGG + Intronic
1007729854 6:43939269-43939291 GGTGCCACCCTCTGCGAGGCGGG - Intergenic
1011614630 6:89186483-89186505 GAGTCCCACATCTGCAGGGCGGG - Intronic
1015551484 6:134416748-134416770 GGGTCCCTCCTCTGCGGCGCAGG - Intergenic
1017439674 6:154452052-154452074 GAGTCAATCGTCTGCGGGGGAGG + Intronic
1020336105 7:7063501-7063523 GTGTACACCCTCTGCGAGACTGG - Intergenic
1029935572 7:104420856-104420878 GAATTCACCCTTTGGGGGGCCGG - Intronic
1030100976 7:105944981-105945003 AAGTCCACAATCTGCAGGGCAGG + Intronic
1033593953 7:142841047-142841069 GAGACCACCCTCTGAGAGGTTGG + Intergenic
1035188441 7:157144022-157144044 GAGTCCACTGACTGCGGAGCTGG + Intronic
1035448185 7:158957264-158957286 GATTCCAACCTCTGCGGCGCTGG + Intergenic
1038777321 8:30542840-30542862 GGGACCACCCTCAGAGGGGCTGG - Intronic
1039963313 8:42266155-42266177 GAGTCCTTTCTCTGCAGGGCTGG + Intergenic
1041745470 8:61204068-61204090 GATTCCACTCTCAGTGGGGCTGG + Intronic
1047772472 8:128040389-128040411 AAGTCCAAACTCTGCAGGGCAGG - Intergenic
1048009244 8:130443240-130443262 GCGGCCAGGCTCTGCGGGGCCGG - Intronic
1048972477 8:139652933-139652955 GAATTCACCATCTTCGGGGCAGG + Intronic
1049598839 8:143497921-143497943 GAGTCCCCTCTCTGCCTGGCAGG + Intronic
1049839732 8:144763246-144763268 GAGTGCACAGTCTGCTGGGCTGG + Intergenic
1054715716 9:68556124-68556146 AAGTCCTCACTCTGTGGGGCTGG - Intergenic
1054812332 9:69444841-69444863 AAGCGCACCCTCTCCGGGGCTGG + Intronic
1055090875 9:72364421-72364443 GCGTGCCGCCTCTGCGGGGCCGG - Intronic
1056076361 9:83045018-83045040 AAGTCCAAACTCTGCAGGGCAGG - Intronic
1057304233 9:93903160-93903182 GACAACACCCTGTGCGGGGCAGG - Intergenic
1059469704 9:114495437-114495459 GAGTCCAGCCTCCCTGGGGCTGG + Intronic
1062186283 9:135220365-135220387 GATTTCAGCCTCTGCGGGGAAGG + Intergenic
1062627141 9:137448451-137448473 CAGTCCACCAGCTGCGCGGCCGG + Exonic
1192442169 X:71182653-71182675 GACTCCTCCCTCAGTGGGGCCGG - Intergenic
1195610584 X:106862912-106862934 GTGTGCTACCTCTGCGGGGCTGG + Intronic
1199628313 X:149759960-149759982 GACTCCACCCTGTGCTGAGCAGG + Intergenic
1200252666 X:154562004-154562026 GGGTGCTCCCTCTGTGGGGCTGG + Intronic
1200265101 X:154642412-154642434 GGGTGCTCCCTCTGTGGGGCTGG - Intergenic